CARKD (NAXD) (NM_001242881) Human Untagged Clone

CAT#: SC331910

CARKD (untagged) - Homo sapiens carbohydrate kinase domain containing (CARKD), transcript variant 2



  "NM_001242881" in other vectors (2)

CNY 3330.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-CARKD Antibody
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CARKD; LP3298; PEBEL2
Vector pCMV6-Entry
Sequence Data
>SC331910 representing NM_001242881.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGTCACACGCGCGGGGGCCGGAACTGCCGTCGCCGGCGCGGTCGTTGTCGCATTGCTCTCGGCCGCA
CTCGCGCTGTACGGGCCGCCACTGGACGCAGTTTTAGAAAGAGCGTTTTCGCTACGTAAAGCACATTCG
ATAAAGGATATGGAAAATACTTTGCAGCTGGTGAGAAATATCATACCTCCTCTGTCTTCCACAAAGCAC
AAAGGGCAAGATGGAAGAATAGGCGTAGTTGGAGGCTGTCAGGAGTACACTGGAGCCCCATATTTTGCA
GCAATCTCAGCTCTCAAAGTGGGCGCAGACTTGTCCCACGTGTTCTGTGCCAGTGCGGCCGCACCTGTG
ATTAAGGCCTACAGCCCGGAGCTGATCGTCCACCCAGTTCTTGACAGCCCCAATGCTGTTCATGAGGTG
GAGAAGTGGCTGCCCCGGCTGCATGCTCTTGTCGTAGGACCTGGCTTGGGTAGAGATGATGCGCTTCTC
AGAAATGTCCAGGGCATTTTGGAAGTGTCAAAGGCCAGGGACATCCCTGTTGTCATCGACGCGGATGGC
CTGTGGCTGGTCGCTCAGCAGCCGGCCCTCATCCATGGCTACCGGAAGGCTGTGCTCACTCCCAACCAC
GTGGAGTTCAGCAGACTGTATGACGCTGTGCTCAGAGGCCCTATGGACAGCGATGACAGCCATGGATCT
GTGCTAAGACTCAGCCAAGCCCTGGGCAACGTGACGGTGGTCCAGAAAGGAGAGCGCGACATCCTCTCC
AACGGCCAGCAGGTGCTTGTGTGCAGCCAGGAAGGCAGCAGCCGCAGGTGTGGAGGGCAAGGGGACCTC
CTGTCGGGCTCCCTGGGCGTCCTGGTACACTGGGCGCTCCTTGCTGGACCACAGAAAACAAATGGGTCC
AGCCCTCTCCTGGTGGCCGCGTTTGGCGCCTGCTCTCTCACCAGGCAGTGCAACCACCAAGCCTTCCAG
AAGCACGGTCGCTCCACCACCACCTCCGACATGATCGCCGAGGTGGGGGCCGCCTTCAGCAAGCTCTTT
GAAACCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001242881
Insert Size 1044 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001242881.1
RefSeq Size 2620 bp
RefSeq ORF 1044 bp
Locus ID 55739
UniProt ID Q8IW45
Protein Families Transmembrane
MW 36.6 kDa
Gene Summary Catalyzes the dehydration of the S-form of NAD(P)HX at the expense of ATP, which is converted to ADP. Together with NAD(P)HX epimerase, which catalyzes the epimerization of the S- and R-forms, the enzyme allows the repair of both epimers of NAD(P)HX, a damaged form of NAD(P)H that is a result of enzymatic or heat-dependent hydration.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate splice site that causes a frameshift in the 3' coding region, compared to variant 1. The encoded isoform (b) has a distinct and shorter C-terminus, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...