BRF1 (NM_001242790) Human Untagged Clone

CAT#: SC331860

BRF1 (untagged) - Homo sapiens BRF1, RNA polymerase III transcription initiation factor 90 kDa subunit (BRF1), transcript variant 8



  "NM_001242790" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


BRF1 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BRF; BRF-1; CFDS; GTF3B; hBRF; HEL-S-76p; TAF3B2; TAF3C; TAFIII90; TF3B90; TFIIIB90
Vector pCMV6-Entry
Sequence Data
>SC331860 representing NM_001242790.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGACGGGCCGCGTGTGCCGCGGTTGCGGCGGCACGGACATCGAGCTGGACGCGGCGCGCGGGGACGCG
GTGTGCACCGCCTGCGGCTCAGTGCTGGAGGACAACATCATCGTGTCCGAGGTGCAGTTCGTGGAGAGC
AGCGGCGGCGGCTCCTCGGCCGTGGGCCAGTTCGTGTCCCTGGACGGTGCTGGCAAAACCCCGACTCTG
GGTGGCGGCTTCCACGTGAATCTGGGGAAGGAGTCGAGAGCGCAGACCCTGCAGAATGGGAGGCGCCAC
ATCCACCACCTGGGGAACCAGCTGCAGCTGAACCAGCACTGCCTGGACACCGCCTTCAACTTCTTCAAG
ATGGCCGTGAGCAGGCACCTGACCCGCGGCCGGAAGATGGCCCACGTGATTGCTGCCTGCCTCTACCTG
GTCTGCCGTACGGAGGGCACGCCGCACATGCTCCTGGACCTCAGCGACCTGCTCCAGGTAGACAGCCTC
CGTCCTGCATCTTTCCCCACCTGGGGTTGTGACCTGGGGGTTGTGACCAGGGTTGTGACCGGGGTGTAC
CCCAGGTGCCTCCACGCATCTCAGTGGCCGGTCTGTGCTGCCTGCCCAGTCAGGAAGTTTTGGTCTGTA
GGATGA

Restriction Sites SgfI-MluI     
ACCN NM_001242790
Insert Size 627 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001242790.1
RefSeq Size 1170 bp
RefSeq ORF 627 bp
Locus ID 2972
UniProt ID Q92994
Protein Families Transcription Factors
MW 22.3 kDa
Gene Summary This gene encodes one of the three subunits of the RNA polymerase III transcription factor complex. This complex plays a central role in transcription initiation by RNA polymerase III on genes encoding tRNA, 5S rRNA, and other small structural RNAs. The gene product belongs to the TF2B family. Several alternatively spliced variants encoding different isoforms, that function at different promoters transcribed by RNA polymerase III, have been identified. [provided by RefSeq, Jun 2011]
Transcript Variant: This variant (8) differs in the 3' UTR and coding sequence compared to variant 1. The resulting isoform (8) has a shorter and distinct C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...