Ikaros (IKZF1) (NM_001220774) Human Untagged Clone

CAT#: SC331779

IKZF1 (untagged) - Homo sapiens IKAROS family zinc finger 1 (Ikaros) (IKZF1), transcript variant 11



  "NM_001220774" in other vectors (2)

CNY 3140.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal anti-IKZF1 antibody
    • 50 ug

CNY 4628.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms hIk-1; Hs.54452; IK1; IKAROS; LYF1; PRO0758; ZNFN1A1
Vector pCMV6-Entry
Sequence Data
>SC331779 representing NM_001220774.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGATGCTGATGAGGGTCAAGACATGTCCCAAGTTTCAGTTGGTAAACCTCACAAATGTGGATATTGT
GGCCGAAGCTATAAACAGCGAAGCTCTTTAGAGGAACATAAAGAGCGCTGCCACAACTACTTGGAAAGC
ATGGGCCTTCCGGGCACACTGTACCCAGTCATTAAAGAAGAAACTAATCACAGTGAAATGGCAGAAGAC
CTGTGCAAGATAGGATCAGAGAGATCTCTCGTGCTGGACAGACTAGCAAGTAACGTCGCCAAACGGGAC
AAGGGCCTGTCCGACACGCCCTACGACAGCAGCGCCAGCTACGAGAAGGAGAACGAAATGATGAAGTCC
CACGTGATGGACCAAGCCATCAACAACGCCATCAACTACCTGGGGGCCGAGTCCCTGCGCCCGCTGGTG
CAGACGCCCCCGGGCGGTTCCGAGGTGGTCCCGGTCATCAGCCCGATGTACCAGCTGCACAAGCCGCTC
GCGGAGGGCACCCCGCGCTCCAACCACTCGGCCCAGGACAGCGCCGTGGAGAACCTGCTGCTGCTCTCC
AAGGCCAAGTTGGTGCCCTCGGAGCGCGAGGCGTCCCCGAGCAACAGCTGCCAAGACTCCACGGACACC
GAGAGCAACAACGAGGAGCAGCGCAGCGGTCTCATCTACCTGACCAACCACATCGCCCCGCACGCGCGC
AACGGGCTGTCGCTCAAGGAGGAGCACCGCGCCTACGACCTGCTGCGCGCCGCCTCCGAGAACTCGCAG
GACGCGCTCCGCGTGGTCAGCACCAGCGGGGAGCAGATGAAGGTGTACAAGTGCGAACACTGCCGGGTG
CTCTTCCTGGATCACGTCATGTACACCATCCACATGGGCTGCCACGGCTTCCGTGATCCTTTTGAGTGC
AACATGTGCGGCTACCACAGCCAGGACCGGTACGAGTTCTCGTCGCACATAACGCGAGGGGAGCACCGC
TTCCACATGAGCTAA

Restriction Sites SgfI-MluI     
ACCN NM_001220774
Insert Size 981 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001220774.1
RefSeq Size 5638 bp
RefSeq ORF 981 bp
Locus ID 10320
Protein Families Druggable Genome, Transcription Factors
MW 36.6 kDa
Gene Summary This gene encodes a transcription factor that belongs to the family of zinc-finger DNA-binding proteins associated with chromatin remodeling. The expression of this protein is restricted to the fetal and adult hemo-lymphopoietic system, and it functions as a regulator of lymphocyte differentiation. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. Most isoforms share a common C-terminal domain, which contains two zinc finger motifs that are required for hetero- or homo-dimerization, and for interactions with other proteins. The isoforms, however, differ in the number of N-terminal zinc finger motifs that bind DNA and in nuclear localization signal presence, resulting in members with and without DNA-binding properties. Only a few isoforms contain the requisite three or more N-terminal zinc motifs that confer high affinity binding to a specific core DNA sequence element in the promoters of target genes. The non-DNA-binding isoforms are largely found in the cytoplasm, and are thought to function as dominant-negative factors. Overexpression of some dominant-negative isoforms have been associated with B-cell malignancies, such as acute lymphoblastic leukemia (ALL). [provided by RefSeq, May 2014]
Transcript Variant: This variant (11) lacks two consecutive in-frame coding exons, and uses an alternate in-frame donor splice site at another coding exon compared to variant 1. This results in a shorter isoform (11, also known as Ik-7(del) as described by Ezzat et al. in PMID:12937159) missing two internal protein segments compared to isoform 1. This isoform contains only one N-terminal zinc finger motif, and represents a non-DNA-binding, dominant negative isoform (PMID:9892693).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...