CD23 (FCER2) (NM_001207019) Human Untagged Clone

CAT#: SC331740

FCER2 (untagged) - Homo sapiens Fc fragment of IgE, low affinity II, receptor for (CD23) (FCER2), transcript variant 2



  "NM_001207019" in other vectors (2)

CNY 3140.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
FCER2 mouse monoclonal antibody, clone OTI2B6 (formerly 2B6)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BLAST-2; CD23; CD23A; CLEC4J; FCE2; IGEBF
Vector pCMV6-Entry
Sequence Data
>SC331740 representing NM_001207019.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAATCCTCCAAGCCAGGAGATCGAGGAGCTTCCCAGGAGGCGGTGTTGCAGGCGTGGGACTCAGATC
GTGCTGCTGGGGCTGGTGACCGCCGCTCTGTGGGCTGGGCTGCTGACTCTGCTTCTCCTGTGGCACTGG
GACACCACACAGAGTCTAAAACAGCTGGAAGAGAGGGCTGCCCGGAACGTCTCTCAAGTTTCCAAGAAC
TTGGAAAGCCACCACGGTGACCAGATGGCGCAGAAATCCCAGTCCACGCAGATTTCACAGGAACTGGAG
GAACTTCGAGCTGAACAGCAGAGATTGAAATCTCAGGACTTGGAGCTGTCCTGGAACCTGAACGGGCTT
CAAGCAGATCTGAGCAGCTTCAAGTCCCAGGAATTGAACGAGAGGAACGAAGCTTCAGATTTGCTGGAA
AGACTCCGGGAGGAGGTGACAAAGCTAAGGATGGAGTTGCAGGTGTCCAGCGGCTTTGTGTGCAACACG
TGCCCTGAAAAGTGGATCAATTTCCAACGGAAGTGCTACTACTTCGGCAAGGGCACCAAGCAGTGGGTC
CACGCCCGGTATGCCTGTGACGACATGGAAGGGCAGCTGGTCAGCATCCACAGCCCGGAGGAGCAGGAC
TTCCTGACCAAGCATGCCAGCCACACCGGCTCCTGGATTGGCCTTCGGAACTTGGACCTGAAGGGGGAG
TTTATCTGGGTGGATGGGAGCCACGTGGACTACAGCAACTGGGCTCCAGGGGAGCCCACCAGCCGGAGC
CAGGGCGAGGACTGCGTGATGATGCGGGGCTCCGGTCGCTGGAACGACGCCTTCTGCGACCGTAAGCTG
GGCGCCTGGGTGTGCGACCGGCTGGCCACATGCACGCCGCCAGCCAGCGAAGGTTCCGCGGAGTCCATG
GGACCTGATTCAAGACCAGACCCTGACGGCCGCCTGCCCACCCCCTCTGCCCCTCTCCACTCTTGA

Restriction Sites SgfI-MluI     
ACCN NM_001207019
Insert Size 963 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001207019.2
RefSeq Size 1488 bp
RefSeq ORF 963 bp
Locus ID 2208
UniProt ID P06734
Protein Families Secreted Protein, Transmembrane
Protein Pathways Hematopoietic cell lineage
MW 36.3 kDa
Gene Summary The protein encoded by this gene is a B-cell specific antigen, and a low-affinity receptor for IgE. It has essential roles in B cell growth and differentiation, and the regulation of IgE production. This protein also exists as a soluble secreted form, then functioning as a potent mitogenic growth factor. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jul 2011]
Transcript Variant: This variant (2) contains an alternate 5' terminal exon and it thus differs in the 5' UTR and 5' coding region, compared to variant 1. The encoded isoform (b, also known as CD23b) is shorter and has a distinct N-terminus, compared to isoform a. This variant is supported by data in PubMed IDs 12379312 and 15843555. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...