RAGE (AGER) (NM_001206966) Human Untagged Clone

CAT#: SC331723

AGER (untagged) - Homo sapiens advanced glycosylation end product-specific receptor (AGER), transcript variant 9



  "NM_001206966" in other vectors (2)

CNY 3330.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit polyclonal AGER Antibody (N-term)
    • 400 ul

CNY 6160.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms RAGE; SCARJ1; sRAGE
Vector pCMV6-Entry
Sequence Data
>SC331723 representing NM_001206966.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCAGCCGGAACAGCAGTTGGAGCCTGGGTGCTGGTCCTCAGTCTGTGGGGGGCAGTAGTAGGTGCT
CAAAACATCACAGCCCGGATTGGCGAGCCACTGGTGCTGAAGTGTAAGGGGGCCCCCAAGAAACCACCC
CAGCGGCTGGAATGGAAACTGAACACAGGCCGGACAGAAGCTTGGAAGGTCCTGTCTCCCCAGGGAGGA
GGCCCCTGGGACAGTGTGGCTCGTGTCCTTCCCAACGGCTCCCTCTTCCTTCCGGCTGTCGGGATCCAG
GATGAGGGGATTTTCCGGTGCCAGGCAATGAACAGGAATGGAAAGGAGACCAAGTCCAACTACCGAGTC
CGTGTCTACCAGATTCCTGGGAAGCCAGAAATTGTAGATTCTGCCTCTGAACTCACGGCTGGTGTTCCC
AATAAGGTGGGGACATGTGTGTCAGAGGGAAGCTACCCTGCAGGGACTCTTAGCTGGCACTTGGATGGG
AAGCCCCTGGTGCCTAATGAGAAGGGAGTATCTGTGAAGGAACAGACCAGGAGACACCCTGAGACAGGG
CTCTTCACACTGCAGTCGGAGCTAATGGTGACCCCAGCCCGGGGAGGAGATCCCCGTCCCACCTTCTCC
TGTAGCTTCAGCCCAGGCCTTCCCCGACACCGGGCCTTGCGCACAGCCCCCATCCAGCCCCGTGTCTGG
GAGCCTGTGCCTCTGGAGGAGGTCCAATTGGTGGTGGAGCCAGAAGGTGGAGCAGTAGCTCCTGGTGGA
ACCGTAACCCTGACCTGTGAAGTCCCTGCCCAGCCCTCTCCTCAAATCCACTGGATGAAGGATGGTGTG
CCCTTGCCCCTTCCCCCCAGCCCTGTGCTGATCCTCCCTGAGATAGGGCCTCAGGACCAGGGAACCTAC
AGCTGTGTGGCCACCCATTCCAGCCACGGGCCCCAGGAAAGCCGTGCTGTCAGCATCAGCATCATCGAA
CCAGGCGAGGAGGGGCCAACTGCAGGTGAGGGGTTTGATAAAGTCAGGGAAGCAGAAGATAGCCCCCAA
CACATGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001206966
Insert Size 1044 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001206966.1
RefSeq Size 1365 bp
RefSeq ORF 1044 bp
Locus ID 177
UniProt ID Q15109
Protein Families Druggable Genome, Secreted Protein, Transmembrane
MW 37.1 kDa
Gene Summary The advanced glycosylation end product (AGE) receptor encoded by this gene is a member of the immunoglobulin superfamily of cell surface receptors. It is a multiligand receptor, and besides AGE, interacts with other molecules implicated in homeostasis, development, and inflammation, and certain diseases, such as diabetes and Alzheimer's disease. Many alternatively spliced transcript variants encoding different isoforms, as well as non-protein-coding variants, have been described for this gene (PMID:18089847). [provided by RefSeq, May 2011]
Transcript Variant: This variant (9, also known as RAGE_v10) lacks the penultimate coding exon, and uses alternate splice sites at other exons at the 3' end compared to variant 1. This results in a frame-shift and a shorter isoform (6, also known as esRAGE and soluble RAGE) with a distinct C-terminus compared to isoform 1. Variants 6 and 9 encode the same isoform. Sequence Note: This Refseq, containing two in-frame translation initiation codons (at nt 8-10 and nt 101-103), is annotated with a CDS starting from the downstream AUG (dAUG) because the AGE receptor encoded by this gene is a known type 1 transmembrane protein requiring signal peptide for its function, and a signal peptide of 22 aa is predicted for the dAUG initiated protein. Translation initiation from the upstream AUG (uAUG) will add an extra 31 aa to the N-terminus, and no signal peptide is predicted for the uAUG initiated protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...