TGN46 (TGOLN2) (NM_001206840) Human Untagged Clone

CAT#: SC331691

TGOLN2 (untagged) - Homo sapiens trans-golgi network protein 2 (TGOLN2), transcript variant 2



  "NM_001206840" in other vectors (2)

CNY 4560.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TGN46/TGOLN2 Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms hTGN46; hTGN48; hTGN51; TGN38; TGN46; TGN48; TGN51; TTGN2
Vector pCMV6-Entry
Sequence Data
>SC331691 representing NM_001206840.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCGGTTCGTGGTTGCCTTGGTCCTCCTGAACGTCGCAGCGGCGGGAGCCGTGCCGCTCTTGGCCACC
GAAAGCGTCAAGCAAGAAGAAGCTGGAGTACGGCCTTCTGCAGGAAACGTCTCCACCCACCCCAGCTTG
AGCCAACGGCCTGGAGGCTCTACCAAGTCGCATCCGGAGCCGCAGACTCCAAAAGACAGCCCTAGCAAG
TCGAGTGCGGAGGCGCAGACCCCAGAAGACACCCCCAACAAGTCGGGTGCGGAGGCAAAGACCCAAAAA
GACAGCTCCAACAAGTCGGGTGCGGAGGCAAAGACCCAAAAAGGCAGCACTAGCAAGTCGGGTTCGGAG
GCGCAGACCACAAAAGACAGCACTAGTAAGTCGCATCCGGAGCTGCAGACTCCAAAAGACAGCACTGGC
AAATCGGGTGCGGAGGCGCAGACCCCAGAAGACAGCCCCAACAGGTCGGGTGCGGAGGCAAAGACCCAA
AAAGACAGCCCTAGCAAGTCAGGTTCGGAGGCGCAGACCACAAAAGATGTCCCTAATAAGTCGGGTGCG
GACGGCCAGACCCCAAAAGACGGCTCCAGCAAGTCGGGTGCGGAGGATCAGACCCCAAAAGACGTCCCT
AACAAGTCGGGTGCGGAGAAGCAGACTCCAAAAGACGGCTCTAACAAGTCCGGTGCAGAGGAGCAGGGC
CCAATAGACGGGCCCAGCAAGTCGGGTGCGGAGGAGCAGACCTCAAAAGACAGCCCTAACAAGGTGGTT
CCAGAGCAGCCTTCCCGGAAAGACCATTCCAAGCCCATCTCCAACCCTTCTGATAACAAGGAGCTCCCC
AAGGCTGACACAAACCAGCTTGCTGACAAAGGGAAGCTTTCTCCTCATGCTTTCAAAACCGAATCTGGG
GAGGAAACTGACCTCATTTCTCCCCCGCAGGAGGAAGTTAAGTCTTCAGAGCCTACTGAGGATGTGGAG
CCCAAAGAGGCTGAAGATGATGATACAGGACCCGAGGAGGGCTCACCGCCCAAAGAAGAGAAAGAAAAG
ATGTCCGGTTCTGCCTCCAGTGAGAACCGTGAAGGGACACTTTCGGATTCCACGGGTAGCGAGAAGGAT
GACCTTTATCCGAACGGTTCTGGAAATGGCAGCGCGGAGAGCAGCCACTTCTTTGCATATCTGGTGACT
GCAGCCATTCTTGTGGCTGTCCTCTATATCGCTCATCACAACAAGCGGAAGATCATTGCTTTTGTCCTG
GAAGGAAAAAGATCTAAAGTCACCCGGCGGCCAAAGGCCAGTGACTACCAACGTTTGGACCAGAAGTAT
GTCTTAATTCTGAATGTTTTCCCTGCACCTCCTAAAAGATCTTTTTTCCCCCAAGTCCTAACAGAATGG
TATATTCCTCTGGAAAAAGATGAACGTCACCAATGGATTGTGCTGCTCTCGTTTCAGCTTTGA

Restriction Sites SgfI-MluI     
ACCN NM_001206840
Insert Size 1443 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001206840.1
RefSeq Size 6431 bp
RefSeq ORF 1443 bp
Locus ID 10618
UniProt ID O43493
Protein Families Transmembrane
MW 51.1 kDa
Gene Summary This gene encodes a type I integral membrane protein that is localized to the trans-Golgi network, a major sorting station for secretory and membrane proteins. The encoded protein cycles between early endosomes and the trans-Golgi network, and may play a role in exocytic vesicle formation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (2, A allele) uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) has a longer and distinct C-terminus, compared to isoform 1. This variant (2, A allele) differs at 1 nt position compared to variant 2, B allele. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...