NSFL1C (NM_001206736) Human Untagged Clone

CAT#: SC331676

NSFL1C (untagged) - Homo sapiens NSFL1 (p97) cofactor (p47) (NSFL1C), transcript variant 4



  "NM_001206736" in other vectors (2)

CNY 3610.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
NSFL1C Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms dJ776F14.1; P47; UBX1; UBXD10; UBXN2C
Vector pCMV6-Entry
Sequence Data
>SC331676 representing NM_001206736.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCGGCGGAGCGACAGGAGGCGCTGAGGGAGTTCGTGGCGGTGACGGGCGCCGAGGAGGACCGGGCC
CGCTTCTTTCTCGAGTCGGCCGGCTGGGACTTGCAGATCGCGCTAGCGAGCTTTTATGAGGACGGAGGG
GATGAAGACATTGTGACCATTTCGCAGGCAACCCCCAGTTCAGTGTCCAGAGGCACAGCCCCCAGTGAT
AATAGAGTGACATCCTTCAGAGACCTCATTCATGACCAAGATGAAGATGAGGAGGAAGAGGAAGGCCAG
AGGAGCAGGTTTTATGCTGGGGGCTCAGAGAGAAGTGGACAGCAGATTGTTGGCCCTCCCAGGAAGAAA
AGTCCCAACGAGCTGGTGGATGATCTCTTTAAAGGTGCCAAAGAGCATGGAGCTGTAGCTGTGGAGCGA
GTGACCAAGAGCCCTGGAGAGACCAGTAAACCGAGACCATTTGCAGGAGGTGGCTACCGCCTTGGGGCA
GCACCAGAGGAAGAGTCTGCCTATGTGGCAGGAGAAAAGAGGCAGCATTCCAGCCAAGATGTTCATGTA
GTATTGAAACTCTGGAAGAGTGGATTCAGCCTGGATAATGGAGAACTCAGAAGCTACCAAGACCCATCC
AATGCCCAGTTTCTGGAGTCTATCCGCAGAGGGGAGGTGCCAGCAGAGCTTCGGAGGCTAGCTCACGGT
GGACAGGTGAACTTGGATATGGAGGACCATCGGGACGAGGACTTTGTGAAGCCCAAAGGAGCCTTCAAA
GCCTTCACTGGCGAGGGTCAGAAACTGGGCAGCACTGCCCCCCAGGTGTTGAGTACCAGCTCTCCAGCC
CAACAGGCAGAAAATGAAGCCAAAGCCAGCTCTTCCATCTTAATCGACGAATCAGAGCCTACCACAAAC
ATCCAAATTCGGCTTGCAGACGGCGGGAGGCTGGTGCAGAAATTTAACCACAGCCACAGGATCAGCGAC
ATCCGACTCTTCATCGTGGATGCCCGGCCAGCCATGGCTGCCACCAGCTTTATCCTCATGACTACTTTC
CCGAACAAAGAGCTGGCTGATGAGAGCCAGACCCTGAAGGAAGCCAACCTGCTCAATGCTGTCATCGTG
CAGCGGTTAACATAA

Restriction Sites SgfI-MluI     
ACCN NM_001206736
Insert Size 1119 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001206736.1
RefSeq Size 3574 bp
RefSeq ORF 1119 bp
Locus ID 55968
UniProt ID Q9UNZ2
MW 40.8 kDa
Gene Summary N-ethylmaleimide-sensitive factor (NSF) and valosin-containing protein (p97) are two ATPases known to be involved in transport vesicle/target membrane fusion and fusions between membrane compartments. A trimer of the protein encoded by this gene binds a hexamer of cytosolic p97 and is required for p97-mediated regrowth of Golgi cisternae from mitotic Golgi fragments. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 8. [provided by RefSeq, May 2011]
Transcript Variant: This variant (4) includes an alternate in-frame exon in the central coding region, compared to variant 1, resulting in an isoform (d) that is longer than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...