EHF (NM_001206616) Human Untagged Clone

CAT#: SC331666

EHF (untagged) - Homo sapiens ets homologous factor (EHF), transcript variant 1



  "NM_001206616" in other vectors (2)

CNY 3140.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal anti-EHF antibody
    • 100 ul

CNY 5250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ESE3; ESE3B; ESEJ
Vector pCMV6-Entry
Sequence Data
>SC331666 representing NM_001206616.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGGTTGCCGGAGAGAAGAGGATTGGTCCTGCTTTTAAGCCTAGCTGAAATTCTTTTCAAGATCATG
ATTCTGGAAGGAGGTGGTGTAATGAATCTCAACCCCGGCAACAACCTCCTTCACCAGCCGCCAGCCTGG
ACAGACAGCTACTCCACGTGCAATGTTTCCAGTGGGTTTTTTGGAGGCCAGTGGCATGAAATTCATCCT
CAGTACTGGACCAAGTACCAGGTGTGGGAGTGGCTCCAGCACCTCCTGGACACCAACCAGCTGGATGCC
AATTGTATCCCTTTCCAAGAGTTCGACATCAACGGCGAGCACCTCTGCAGCATGAGTTTGCAGGAGTTC
ACCCGGGCGGCAGGGACGGCGGGGCAGCTCCTCTACAGCAACTTGCAGCATCTGAAGTGGAACGGCCAG
TGCAGTAGTGACCTGTTCCAGTCCACACACAATGTCATTGTCAAGACTGAACAAACTGAGCCTTCCATC
ATGAACACCTGGAAAGACGAGAACTATTTATATGACACCAACTATGGTAGCACAGTAGATTTGTTGGAC
AGCAAAACTTTCTGCCGGGCTCAGATCTCCATGACAACCACCAGTCACCTTCCTGTTGCAGAGTCACCT
GATATGAAAAAGGAGCAAGACCCCCCTGCCAAGTGCCACACCAAAAAGCACAACCCGAGAGGGACTCAC
TTATGGGAATTCATCCGCGACATCCTCTTGAACCCAGACAAGAACCCAGGATTAATAAAATGGGAAGAC
CGATCTGAGGGCGTCTTCAGGTTCTTGAAATCAGAGGCAGTGGCTCAGCTATGGGGTAAAAAGAAGAAC
AACAGCAGCATGACCTATGAAAAGCTCAGCCGAGCTATGAGATATTACTACAAAAGAGAAATTCTGGAG
CGTGTGGATGGACGAAGACTGGTATATAAATTTGGGAAGAATGCCCGAGGATGGAGAGAAAATGAAAAC
TGA

Restriction Sites SgfI-MluI     
ACCN NM_001206616
Insert Size 969 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001206616.1
RefSeq Size 5467 bp
RefSeq ORF 969 bp
Locus ID 26298
UniProt ID Q9NZC4
Protein Families Transcription Factors
MW 37.4 kDa
Gene Summary This gene encodes a protein that belongs to an ETS transcription factor subfamily characterized by epithelial-specific expression (ESEs). The encoded protein acts as a transcriptional repressor and may be involved in epithelial differentiation and carcinogenesis. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...