CD162 (SELPLG) (NM_001206609) Human Untagged Clone

CAT#: SC331663

SELPLG (untagged) - Homo sapiens selectin P ligand (SELPLG), transcript variant 1



  "NM_001206609" in other vectors (2)

CNY 4090.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-SELPLG Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CD162; CLA; PSGL-1; PSGL1
Vector pCMV6-Entry
Sequence Data
>SC331663 representing NM_001206609.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCAGTGGGGGCCAGTGGTCTAGAAGGAGATAAGATGGCTGGTGCCATGCCTCTGCAACTCCTCCTG
TTGCTGATCCTACTGGGCCCTGGCAACAGCTTGCAGCTGTGGGACACCTGGGCAGATGAAGCCGAGAAA
GCCTTGGGTCCCCTGCTTGCCCGGGACCGGAGACAGGCCACCGAATATGAGTACCTAGATTATGATTTC
CTGCCAGAAACGGAGCCTCCAGAAATGCTGAGGAACAGCACTGACACCACTCCTCTGACTGGGCCTGGA
ACCCCTGAGTCTACCACTGTGGAGCCTGCTGCAAGGCGTTCTACTGGCCTGGATGCAGGAGGGGCAGTC
ACAGAGCTGACCACGGAGCTGGCCAACATGGGGAACCTGTCCACGGATTCAGCAGCTATGGAGATACAG
ACCACTCAACCAGCAGCCACGGAGGCACAGACCACTCAACCAGTGCCCACGGAGGCACAGACCACTCCA
CTGGCAGCCACAGAGGCACAGACAACTCGACTGACGGCCACGGAGGCACAGACCACTCCACTGGCAGCC
ACAGAGGCACAGACCACTCCACCAGCAGCCACGGAAGCACAGACCACTCAACCCACAGGCCTGGAGGCA
CAGACCACTGCACCAGCAGCCATGGAGGCACAGACCACTGCACCAGCAGCCATGGAAGCACAGACCACT
CCACCAGCAGCCATGGAGGCACAGACCACTCAAACCACAGCCATGGAGGCACAGACCACTGCACCAGAA
GCCACGGAGGCACAGACCACTCAACCCACAGCCACGGAGGCACAGACCACTCCACTGGCAGCCATGGAG
GCCCTGTCCACAGAACCCAGTGCCACAGAGGCCCTGTCCATGGAACCTACTACCAAAAGAGGTCTGTTC
ATACCCTTTTCTGTGTCCTCTGTTACTCACAAGGGCATTCCCATGGCAGCCAGCAATTTGTCCGTCAAC
TACCCAGTGGGGGCCCCAGACCACATCTCTGTGAAGCAGTGCCTGCTGGCCATCCTAATCTTGGCGCTG
GTGGCCACTATCTTCTTCGTGTGCACTGTGGTGCTGGCGGTCCGCCTCTCCCGCAAGGGCCACATGTAC
CCCGTGCGTAATTACTCCCCCACCGAGATGGTCTGCATCTCATCCCTGTTGCCTGATGGGGGTGAGGGG
CCCTCTGCCACAGCCAATGGGGGCCTGTCCAAGGCCAAGAGCCCGGGCCTGACGCCAGAGCCCAGGGAG
GACCGTGAGGGGGATGACCTCACCCTGCACAGCTTCCTCCCTTAG

Restriction Sites SgfI-MluI     
ACCN NM_001206609
Insert Size 1287 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001206609.1
RefSeq Size 2638 bp
RefSeq ORF 1287 bp
Locus ID 6404
UniProt ID Q14242
Protein Families Druggable Genome, Transmembrane
Protein Pathways Cell adhesion molecules (CAMs)
MW 44.6 kDa
Gene Summary This gene encodes a glycoprotein that functions as a high affinity counter-receptor for the cell adhesion molecules P-, E- and L- selectin expressed on myeloid cells and stimulated T lymphocytes. As such, this protein plays a critical role in leukocyte trafficking during inflammation by tethering of leukocytes to activated platelets or endothelia expressing selectins. This protein requires two post-translational modifications, tyrosine sulfation and the addition of the sialyl Lewis x tetrasaccharide (sLex) to its O-linked glycans, for its high-affinity binding activity. Aberrant expression of this gene and polymorphisms in this gene are associated with defects in the innate and adaptive immune response. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Apr 2011]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...