Caspase 10 (CASP10) (NM_001206542) Human Untagged Clone

CAT#: SC331655

CASP10 (untagged) - Homo sapiens caspase 10, apoptosis-related cysteine peptidase (CASP10), transcript variant 5



  "NM_001206542" in other vectors (2)

CNY 4560.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Anti-CASP10 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ALPS2; FLICE-2; FLICE2; MCH4
Vector pCMV6-Entry
Sequence Data
>SC331655 representing NM_001206542.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAAATCTCAAGGTCAACATTGGTATTCCAGTTCAGATAAAAACTGTAAAGTGAGCTTTCGTGAGAAG
CTTCTGATTATTGATTCAAACCTGGGGGTCCAAGATGTGGAGAACCTCAAGTTTCTCTGCATAGGATTG
GTCCCCAACAAGAAGCTGGAGAAGTCCAGCTCAGCCTCAGATGTTTTTGAACATCTCTTGGCAGAGGAT
CTGCTGAGTGAGGAAGACCCTTTCTTCCTGGCAGAACTCCTCTATATCATACGGCAGAAGAAGCTGCTG
CAGCACCTCAACTGTACCAAAGAGGAAGTGGAGCGACTGCTGCCCACCCGACAAAGGGTTTCTCTGTTT
AGAAACCTGCTCTACGAACTGTCAGAAGGCATTGACTCAGAGAACTTAAAGGACATGATCTTCCTTCTG
AAAGACTCGCTTCCCAAAACTGAAATGACCTCCCTAAGTTTCCTGGCATTTCTAGAGAAACAAGGTAAA
ATAGATGAAGATAATCTGACATGCCTGGAGGACCTCTGCAAAACAGTTGTACCTAAACTTTTGAGAAAC
ATAGAGAAATACAAAAGAGAGAAAGCTATCCAGATAGTGACACCTCCTGTAGACAAGGAAGCCGAGTCG
TATCAAGGAGAGGAAGAACTAGTTTCCCAAACAGATGTTAAGACATTCTTGGAAGCCTTACCGAGGGCA
GCTGTGTACAGGATGAATCGGAACCACAGAGGCCTCTGTGTCATTGTCAACAACCACAGCTTTACCTCC
CTGAAGGACAGACAAGGAACCCATAAAGATGCTGAGATCCTGAGTCATGTGTTCCAGTGGCTTGGGTTC
ACAGTGCATATACACAATAATGTGACGAAAGTGGAAATGGAGATGGTCCTGCAGAAGCAGAAGTGCAAT
CCAGCCCATGCCGACGGGGACTGCTTCGTGTTCTGTATTCTGACCCATGGGAGATTTGGAGCTGTCTAC
TCTTCGGATGAGGCCCTCATTCCCATTCGGGAGATCATGTCTCACTTCACAGCCCTGCAGTGCCCTAGA
CTGGCTGAAAAACCTAAACTCTTTTTCATCCAGGCCTGCCAAGGTGAAGAGATACAGCCTTCCGTATCC
ATCGAAGCAGATGCTCTGAACCCTGAGCAGGCACCCACTTCCCTGCAGGACAGTATTCCTGCCGAGGCT
GACTTCCTACTTGGTCTGGCCACTGTCCCAGGCTATGTATCCTTTCGGCATGTGGAGGAAGGCAGCTGG
TATATTCAGTCTCTGTGTAATCATCTGAAGAAATTGGTCCCAAGGATGCTGAAATTTCTGGAAAAGACA
ATGGAAATCAGGGGCAGGAAGAGAACAGTGTGGGGTGCTAAACAGATCTCAGCAACCTCCCTGCCCACG
GCCATCTCTGCGCAGACACCTCGACCCCCCATGCGCAGGTGGAGCAGCGTTTCCTAG

Restriction Sites SgfI-MluI     
ACCN NM_001206542
Insert Size 1437 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001206542.1
RefSeq Size 2178 bp
RefSeq ORF 1437 bp
Locus ID 843
UniProt ID Q92851
Protein Families Druggable Genome, Protease
Protein Pathways Apoptosis, RIG-I-like receptor signaling pathway
MW 54.5 kDa
Gene Summary This gene encodes a protein which is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce two subunits, large and small, that dimerize to form the active enzyme. This protein cleaves and activates caspases 3 and 7, and the protein itself is processed by caspase 8. Mutations in this gene are associated with type IIA autoimmune lymphoproliferative syndrome, non-Hodgkin lymphoma and gastric cancer. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Apr 2011]
Transcript Variant: This variant (5) lacks two in-frame coding exons and contains an alternate 3' terminal exon compared to variant 1. This results in a shorter isoform (5) missing an internal protein segment and with a distinct C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...