CCN4 (NM_001204869) Human Untagged Clone
CAT#: SC331622
WISP1 (untagged) - Homo sapiens WNT1 inducible signaling pathway protein 1 (WISP1), transcript variant 3
CNY 2950.00
货期*
3周
规格
Product images

推荐一起购买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | WISP1; WISP1-OT1; WISP1-UT1; WISP1c; WISP1i; WISP1tc |
Vector | pCMV6-Entry |
Sequence Data |
>SC331622 representing NM_001204869.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGAGGTGGTTCCTGCCCTGGACGCTGGCAGCAGTGACAGCAGCAGCCGCCAGCACCGTCCTGGCCACG GCCCTCTCTCCAGCCCCTACGACCATGGACTTTACCCCAGCTCCACTGGAGGACACCTCCTCACGCCCC CAATTCTGCAAGTGGCCATGTGAGTGCCCGCCATCCCCACCCCGCTGCCCGCTGGGGGTCAGCCTCATC ACAGATGGCTGTGAGTGCTGTAAGATGTGCGCTCAGCAGCTTGGGGACAACTGCACGGAGGCTGCCATC TGTGACCCCCACCGGGGCCTCTACTGTGACTACAGCGGGGACCGCCCGAGGTACGCAATAGGAGTGTGT GCACGCAGGGAAGAAGTGTCTGGCTGTGTACCAGCCAGAGGCATCCATGAACTTCACACTTGCGGGCTG CATCAGCACACGCTCCTATCAACCCAAGTACTGTGGAGTTTGCATGGACAATAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001204869 |
Insert Size | 468 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001204869.1 |
RefSeq Size | 4739 bp |
RefSeq ORF | 468 bp |
Locus ID | 8840 |
UniProt ID | O95388 |
Protein Families | Adult stem cells, Druggable Genome, Embryonic stem cells, ES Cell Differentiation/IPS, Secreted Protein, Stem cell relevant signaling - DSL/Notch pathway, Stem cell relevant signaling - Wnt Signaling pathway |
MW | 16.8 kDa |
Gene Summary | This gene encodes a member of the WNT1 inducible signaling pathway (WISP) protein subfamily, which belongs to the connective tissue growth factor (CTGF) family. WNT1 is a member of a family of cysteine-rich, glycosylated signaling proteins that mediate diverse developmental processes. The CTGF family members are characterized by four conserved cysteine-rich domains: insulin-like growth factor-binding domain, von Willebrand factor type C module, thrombospondin domain and C-terminal cystine knot-like domain. This gene may be downstream in the WNT1 signaling pathway that is relevant to malignant transformation. It is expressed at a high level in fibroblast cells, and overexpressed in colon tumors. The encoded protein binds to decorin and biglycan, two members of a family of small leucine-rich proteoglycans present in the extracellular matrix of connective tissue, and possibly prevents the inhibitory activity of decorin and biglycan in tumor cell proliferation. It also attenuates p53-mediated apoptosis in response to DNA damage through activation of the Akt kinase. It is 83% identical to the mouse protein at the amino acid level. Multiple alternatively spliced transcript variants have been identified. [provided by RefSeq, Mar 2011] Transcript Variant: This variant (3) lacks two consecutive exons in the coding region, as compared to variant 1. The resulting isoform (3) has a shorter and distinct C-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
Customer
Reviews
Loading...