Kv1.2 (KCNA2) (NM_001204269) Human Untagged Clone
CAT#: SC331540
KCNA2 (untagged) - Homo sapiens potassium voltage-gated channel, shaker-related subfamily, member 2 (KCNA2), transcript variant 2
CNY 3420.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DEE32; EIEE32; HBK5; HK4; HUKIV; KV1.2; MK2; NGK1; RBK2 |
Vector | pCMV6-Entry |
Sequence Data |
>SC331540 representing NM_001204269.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGACAGTGGCCACCGGAGACCCAGCAGACGAGGCTGCTGCCCTCCCTGGGCACCCACAGGACACCTAT GACCCAGAGGCAGACCACGAGTGCTGTGAGAGGGTGGTGATCAACATCTCAGGGCTGCGGTTTGAGACC CAGCTAAAGACCTTAGCCCAGTTTCCAGAGACCCTCTTAGGGGACCCAAAGAAACGAATGAGGTACTTT GACCCCCTCCGAAATGAGTACTTTTTCGATCGGAACCGCCCTAGCTTTGATGCCATTTTGTACTACTAC CAGTCAGGGGGCCGATTGAGGCGACCTGTGAATGTGCCCTTAGATATATTCTCTGAAGAAATTCGGTTT TATGAGCTGGGAGAAGAAGCGATGGAGATGTTTCGGGAAGATGAAGGCTACATCAAGGAGGAAGAGCGT CCTCTGCCTGAAAATGAGTTTCAGAGACAAGTGTGGCTTCTCTTTGAATACCCAGAGAGCTCAGGGCCT GCCAGGATTATAGCTATTGTGTCTGTCATGGTGATTCTGATCTCAATTGTCAGCTTCTGTCTGGAAACA TTGCCCATCTTCCGGGATGAGAATGAAGACATGCATGGTAGTGGGGTGACCTTCCACACCTATTCCAAC AGCACCATCGGGTACCAGCAGTCCACTTCCTTCACAGACCCTTTCTTCATTGTAGAGACACTCTGCATC ATCTGGTTCTCCTTTGAATTCTTGGTGAGGTTCTTTGCCTGTCCCAGCAAAGCCGGCTTCTTCACCAAC ATCATGAACATCATTGACATTGTGGCCATCATCCCCTACTTCATCACCCTGGGGACAGAGTTGGCTGAG AAGCCAGAGGACGCTCAGCAAGGCCAGCAGGCCATGTCACTGGCCATCCTCCGTGTCATCCGGTTGGAA CGCAGACCTCTGCAAAGCCAGAAGAGTAAGCGGGGAAGGCAGCATCTGAACACCTCACATGACTGCACC TTAGGAATTAACCTAGTCGCGGGCATGACTGTACAGTGGACCAGGGCATCTGGTCCTGATGACAGGCAG ACACCAGCTGTAACTACATTGCACAGGATGTATTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001204269 |
Insert Size | 1071 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001204269.1 |
RefSeq Size | 2022 bp |
RefSeq ORF | 1071 bp |
Locus ID | 3737 |
UniProt ID | P16389 |
Protein Families | Druggable Genome, Ion Channels: Potassium, Transmembrane |
MW | 41 kDa |
Gene Summary | Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the delayed rectifier class, members of which allow nerve cells to efficiently repolarize following an action potential. The coding region of this gene is intronless, and the gene is clustered with genes KCNA3 and KCNA10 on chromosome 1. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) has multiple differences, compared to variant 1. These differences result in distinct 5' and 3' ends and cause translation termination at a downstream stop codon, compared to variant 1. The encoded protein (isoform b) is shorter than isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233861 | KCNA2 (Myc-DDK tagged) - Homo sapiens potassium voltage-gated channel, shaker-related subfamily, member 2 (KCNA2), transcript variant 2 |
CNY 4024.00 |
|
RG233861 | KCNA2 (tGFP-tagged) - Homo sapiens potassium voltage-gated channel, shaker-related subfamily, member 2 (KCNA2), transcript variant 2 |
CNY 4370.00 |