NEK2 (NM_001204183) Human Untagged Clone

CAT#: SC331516

NEK2 (untagged) - Homo sapiens NIMA-related kinase 2 (NEK2), transcript variant 2



  "NM_001204183" in other vectors (2)

CNY 3710.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-NEK2 Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HsPK21; NEK2A; NLK1; PPP1R111; RP67
Vector pCMV6-Entry
Sequence Data
>SC331516 representing NM_001204183.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCCTTCCCGGGCTGAGGACTATGAAGTGTTGTACACCATTGGCACAGGCTCCTACGGCCGCTGCCAG
AAGATCCGGAGGAAGAGTGATGGCAAGATATTAGTTTGGAAAGAACTTGACTATGGCTCCATGACAGAA
GCTGAGAAACAGATGCTTGTTTCTGAAGTGAATTTGCTTCGTGAACTGAAACATCCAAACATCGTTCGT
TACTATGATCGGATTATTGACCGGACCAATACAACACTGTACATTGTAATGGAATATTGTGAAGGAGGG
GATCTGGCTAGTGTAATTACAAAGGGAACCAAGGAAAGGCAATACTTAGATGAAGAGTTTGTTCTTCGA
GTGATGACTCAGTTGACTCTGGCCCTGAAGGAATGCCACAGACGAAGTGATGGTGGTCATACCGTATTG
CATCGGGATCTGAAACCAGCCAATGTTTTCCTGGATGGCAAGCAAAACGTCAAGCTTGGAGACTTTGGG
CTAGCTAGAATATTAAACCATGACACGAGTTTTGCAAAAACATTTGTTGGCACACCTTATTACATGTCT
CCTGAACAAATGAATCGCATGTCCTACAATGAGAAATCAGATATCTGGTCATTGGGCTGCTTGCTGTAT
GAGTTATGTGCATTAATGCCTCCATTTACAGCTTTTAGCCAGAAAGAACTCGCTGGGAAAATCAGAGAA
GGCAAATTCAGGCGAATTCCATACCGTTACTCTGATGAATTGAATGAAATTATTACGAGGATGTTAAAC
TTAAAGGATTACCATCGACCTTCTGTTGAAGAAATTCTTGAGAACCCTTTAATAGCAGATTTGGTTGCA
GACGAGCAAAGAAGAAATCTTGAGAGAAGAGGGCGACAATTAGGAGAGCCAGAAAAATCGCAGGATTCC
AGCCCTGTATTGAGTGAGCTGAAACTGAAGGAAATTCAGTTACAGGAGCGAGAGCGAGCTCTCAAAGCA
AGAGAAGAAAGATTGGAGCAGAAAGAACAGGAGCTTTGTGTTCGTGAGAGACTAGCAGAGGACAAACTG
GCTAGAGCAGAAAATCTGTTGAAGAACTACAGCTTGCTAAAGGAACGGAAGTTCCTGTCTCTGGCAAGT
AATCCAGGTATGAGAATCAACTTGGTCAACAGAAGCTGGTGCTACAAATGA

Restriction Sites SgfI-MluI     
ACCN NM_001204183
Insert Size 1155 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001204183.1
RefSeq Size 1938 bp
RefSeq ORF 1155 bp
Locus ID 4751
UniProt ID P51955
Protein Families Druggable Genome, Protein Kinase
MW 44.9 kDa
Gene Summary This gene encodes a serine/threonine-protein kinase that is involved in mitotic regulation. This protein is localized to the centrosome, and undetectable during G1 phase, but accumulates progressively throughout the S phase, reaching maximal levels in late G2 phase. Alternatively spliced transcript variants encoding different isoforms with distinct C-termini have been noted for this gene. [provided by RefSeq, Feb 2011]
Transcript Variant: This variant (2) differs at the 3' end compared to variant 1. This results in a frame-shift and a shorter isoform (2, also known as NEK2B) with a distinct C-terminus compared to isoform 1. Isoforms 1 and 2 have been reported to exhibit distinct pattern of expression during mitosis (PMID:11742531).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...