MDMX (MDM4) (NM_001204171) Human Untagged Clone

CAT#: SC331512

MDM4 (untagged) - Homo sapiens Mdm4 p53 binding protein homolog (mouse) (MDM4), transcript variant 2



  "NM_001204171" in other vectors (2)

CNY 4280.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
MDM4 (MDMX) mouse monoclonal antibody, clone OTI4B5 (formerly 4B5)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BMFS6; HDMX; MDMX; MRP1
Vector pCMV6-Entry
Sequence Data
>SC331512 representing NM_001204171.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGACATCATTTTCCACCTCTGCTCAGTGTTCAACATCTGACAGTGCTTGCAGGATCTCTCCTGGACAA
ATCAATCAGGTACGACCAAAACTGCCGCTTTTGAAGATTTTGCATGCAGCAGGTGCGCAAGGTGAAATG
TTCACTGTTAAAGAGGTCATGCACTATTTAGGTCAGTACATAATGGTGAAGCAACTTTATGATCAGCAG
GAGCAGCATATGGTATATTGTGGTGGAGATCTTTTGGGAGAACTACTGGGACGTCAGAGCTTCTCCGTG
AAAGACCCAAGCCCTCTCTATGATATGCTAAGAAAGAATCTTGTCACTTTAGCCACTGCTACTACAGAT
GCTGCTCAGACTCTCGCTCTCGCACAGGATCACAGTATGGATATTCCAAGTCAAGACCAACTGAAGCAA
AGTGCAGAGGAAAGTTCCACTTCCAGAAAAAGAACTACAGAAGACGATATCCCCACACTGCCTACCTCA
GAGCATAAATGCATACATTCTAGAGAAGATGAAGACTTAATTGAAAATTTAGCCCAAGATGAAACATCT
AGGCTGGACCTTGGATTTGAGGAGTGGGATGTAGCTGGCCTGCCTTGGTGGTTTTTAGGAAACTTGAGA
AGCAACTATACACCTAGAAGTAATGGCTCAACTGATTTACAGACAAATCAGGTGATTGAAGTGGGAAAA
AATGATGACCTGGAGGACTCTAAGTCCTTAAGTGATGATACCGATGTAGAGGTTACCTCTGAGGATGAG
TGGCAGTGTACTGAATGCAAGAAATTTAACTCTCCAAGCAAGAGGTACTGTTTTCGTTGTTGGGCCTTG
AGGAAGGATTGGTATTCAGATTGTTCAAAGTTAACCCATTCTCTCTCCACGTCTGATATCACTGCCATA
CCTGAAAAGGAAAATGAAGGAAATGATGTCCCTGATTGTCGAAGAACCATTTCGGCTCCTGTCGTTAGA
CCTAAAGATGCGTATATAAAGAAAGAAAACTCCAAACTTTTTGATCCCTGCAACTCAGTGGAATTCTTG
GATTTGGCTCACAGTTCTGAAAGCCAAGAGACCATCTCAAGCATGGGAGAACAGTTAGATAACCTTTCT
GAACAGAGAACAGATACAGAAAACATGGAGGATTGCCAGAATCTCTTGAAGCCATGTAGCTTATGTGAG
AAAAGACCACGAGACGGGAACATTATTCATGGAAGGACGGGCCATCTTGTCACTTGTTTTCACTGTGCC
AGAAGACTAAAGAAGGCTGGGGCTTCATGCCCTATTTGCAAGAAAGAGATTCAGCTGGTTATTAAGGTT
TTTATAGCATAA

Restriction Sites SgfI-MluI     
ACCN NM_001204171
Insert Size 1323 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001204171.1
RefSeq Size 9940 bp
RefSeq ORF 1323 bp
Locus ID 4194
UniProt ID O15151
Protein Families Druggable Genome, Transcription Factors
Protein Pathways p53 signaling pathway
MW 49.5 kDa
Gene Summary This gene encodes a nuclear protein that contains a p53 binding domain at the N-terminus and a RING finger domain at the C-terminus, and shows structural similarity to p53-binding protein MDM2. Both proteins bind the p53 tumor suppressor protein and inhibit its activity, and have been shown to be overexpressed in a variety of human cancers. However, unlike MDM2 which degrades p53, this protein inhibits p53 by binding its transcriptional activation domain. This protein also interacts with MDM2 protein via the RING finger domain, and inhibits the latter's degradation. So this protein can reverse MDM2-targeted degradation of p53, while maintaining suppression of p53 transactivation and apoptotic functions. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Feb 2011]
Transcript Variant: This variant (2, also known as MDM4-A or HDMX-A) lacks an in-frame coding exon compared to variant 1, resulting in a shorter isoform (2) missing an internal protein segment in the 3' coding region compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...