PPT2 (NM_001204103) Human Untagged Clone

CAT#: SC331493

PPT2 (untagged) - Homo sapiens palmitoyl-protein thioesterase 2 (PPT2), transcript variant 3



  "NM_001204103" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


PPT2 Antibody - C-terminal region
    • 50 ug

CNY 4,628.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C6orf8; G14; PPT-2
Vector pCMV6-Entry
Sequence Data
>SC331493 representing NM_001204103.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCTGGGGCTCTGCGGGCAGCGGCTCCCCGCGGCGTGGGTCCTGCTTCTGTTGCCTTTCCTGCCGCTG
CTGCTGCTTGCAGCCCCCGCGCCCCACCGCGCGTCCTACAAGCCGGTCATCGTGGTGCATGGGCTCTTC
GACAGCTCGTACAGCTTCCGCCACCTGCTGGAATACATCAATGAGACACACCCCGGGACTGTGGTGACA
GTGCTCGATCTCTTCGATGGGAGAGAGAGCTTGCGACCCCTGTGGGAACAGGTGCAAGGGTTCCGAGAG
GCTGTGGTCCCCATCATGGCAAAGGCCCCTCAAGGGGTGCATCTCATCTGCTACTCGCAGGGGGGCCTT
GTGTGCCGGGCTCTGCTTTCTGTCATGGATGATCACAACGTGGATTCTTTCATCTCCCTCTCCTCTCCA
CAGATGGGACAGTATGGAGACACGGACTACTTGAAGTGGCTGTTCCCCACCTCCATGCGGTCTAACCTC
TATCGGATCTGCTATAGCCCCTGGGGCCAGGAATTCTCCATCTGCAACTACTGGCATGATCCCCACCAC
GATGACTTGTACCTCAATGCCAGCAGCTTCCTGGCCCTGATCAATGGGGAAAGAGACCATCCCAATGCC
ACAGTATGGCGGAAGAACTTTCTGCGTGTGGGCCACCTGGTGCTGATTGGGGGCCCTGATGATGGTGTT
ATTACTCCCTGGCAGTCCAGCTTCTTTGGTTTCTATGATGCAAATGAGACCGTCCTGGAGATGGAGGAG
CAACTGGTTTATCTGCGGGATTCTTTTGGGTTGAAGACTCTATTGGCCCGGGGGGCCATAGTGAGGTGT
CCAATGGCCGGTATCTCCCACACAGCCTGGCACTCCAACCGTACCCTTTATGAGACCTGCATTGAACCT
TGGCTCTCCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001204103
Insert Size 909 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001204103.1
RefSeq Size 2053 bp
RefSeq ORF 909 bp
Locus ID 9374
UniProt ID Q9UMR5
Protein Families Transmembrane
Protein Pathways Fatty acid elongation in mitochondria, Lysosome, Metabolic pathways
MW 34.2 kDa
Gene Summary This gene encodes a member of the palmitoyl-protein thioesterase family. The encoded glycosylated lysosomal protein has palmitoyl-CoA hydrolase activity in vitro, but does not hydrolyze palmitate from cysteine residues in proteins. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream EGFL8 (EGF-like-domain, multiple 8) gene. [provided by RefSeq, Feb 2011]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Both variants 1 and 3 encode the same isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...