MTA1 (NM_001203258) Human Untagged Clone

CAT#: SC331482

MTA1 (untagged) - Homo sapiens metastasis associated 1 (MTA1), transcript variant 2



  "NM_001203258" in other vectors (2)

CNY 4090.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit polyclonal anti-MTA1 antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
Sequence Data
>SC331482 representing NM_001203258.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCCGCCAACATGTACAGGGTCGGAGACTACGTCTACTTTGAGAACTCCTCCAGCAACCCATACCTG
ATCCGGAGAATCGAGGAGCTCAACAAGACGGCCAATGGGAACGTGGAGGCCAAAGTGGTGTGCTTCTAC
CGGAGGCGGGACATCTCCAGCACCCTCATCGCCCTGGCCGACAAGCACGCAACCCTGTCAGTCTGCTAT
AAGGCCGGACCGGGGGCGGACAACGGCGAGGAAGGGGAAATAGAAGAGGAAATGGAGAATCCGGAAATG
GTGGACCTGCCCGAGAAACTAAAGCACCAGCTGCGGCATCGGGAGCTGTTCCTCTCCCGGCAGCTGGAG
TCTCTGCCCGCCACGCACATCAGGGGCAAGTGCAGCGTCACCCTGCTCAACGAGACCGAGTCGCTCAAG
TCCTACCTGGAGCGGGAGGATTTCTTCTTCTATTCTCTAGTCTACGACCCACAGCAGAAGACCCTGCTG
GCAGATAAAGGAGAGATTCGAGTAGGAAACCGGTACCAGGCAGACATCACCGACTTGTTAAAAGAAGGC
GAGGAGGATGGCCGAGACCAGTCCAGGTTGGAGACCCAGGTGTGGGAGGCGCACAACCCACTCACAGAC
AAGCAGATCGACCAGTTCCTGGTGGTGGCCCGCTCTGTGGGCACCTTCGCACGGGCCCTGGACTGCAGC
AGCTCCGTCCGACAGCCCAGCCTGCACATGAGCGCCGCAGCTGCCTCCCGAGACATCACCCTGTTCCAC
GCCATGGATACTCTCCACAAGAACATCTACGACATCTCCAAGGCCATCTCGGCGCTGGTGCCGCAGGGC
GGGCCCGTGCTCTGCAGGGACGAGATGGAGGAGTGGTCTGCATCAGAGGCCAACCTTTTCGAGGAAGCC
CTGGAAAAATATGGGAAGGATTTCACGGACATTCAGCAAGATTTTCTCCCGTGGAAGTCGCTGACCAGC
ATCATTGAGTACTACTACATGTGGAAGACCACCGACAGATACGTGCAGCAGAAACGCTTGAAAGCAGCT
GAAGCTGAGAGCAAGTTAAAGCAAGTTTATATTCCCAACTATAACAAGCCAAATCCGAACCAAATCAGC
GTCAACAACGTCAAGGCCGGTGTGGTGAACGGCACGGGGGCGCCGGGCCAGAGCCCTGGGGCTGGCCGG
GCCTGCGAGAGCTGTTACATGTCGTCTCTGCGCATCTTGTTGGACATATTGGAAGAAATATGGTGGCTT
GAAAATGCCAACCCGGTTAGATGGAGAGAGGCCAGGACCAAACCGCAGTAA

Restriction Sites SgfI-MluI     
ACCN NM_001203258
Insert Size 1293 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001203258.1
RefSeq Size 2809 bp
RefSeq ORF 1293 bp
Locus ID 9112
UniProt ID Q13330
Protein Families Druggable Genome, Transcription Factors
MW 49 kDa
Gene Summary This gene encodes a protein that was identified in a screen for genes expressed in metastatic cells, specifically, mammary adenocarcinoma cell lines. Expression of this gene has been correlated with the metastatic potential of at least two types of carcinomas although it is also expressed in many normal tissues. The role it plays in metastasis is unclear. It was initially thought to be the 70kD component of a nucleosome remodeling deacetylase complex, NuRD, but it is more likely that this component is a different but very similar protein. These two proteins are so closely related, though, that they share the same types of domains. These domains include two DNA binding domains, a dimerization domain, and a domain commonly found in proteins that methylate DNA. The profile and activity of this gene product suggest that it is involved in regulating transcription and that this may be accomplished by chromatin remodeling. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
Transcript Variant: This variant (2) uses an alternate splice junction at the 5' end of a coding exon compared to variant 1, that causes a frameshift. The resulting isoform (MTA1s) has a shorter and distinct C-terminus compared to isoform MTA1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...