Tau (MAPT) (NM_001203252) Human Untagged Clone

CAT#: SC331481

MAPT (untagged) - Homo sapiens microtubule-associated protein tau (MAPT), transcript variant 8



  "NM_001203252" in other vectors (2)

CNY 3900.00


货期*
2周

规格
    • 10 ug

Product images

推荐一起购买 (3)
MAPT mouse monoclonal antibody,clone OTI13B5
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DDPAC; FTDP-17; MAPTL; MSTD; MTBT1; MTBT2; PPND; PPP1R103; TAU; tau-40
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001203252, the custom clone sequence may differ by one or more nucleotides


ATGGCTGAGCCCCGCCAGGAGTTCGAAGTGATGGAAGATCACGCTGGGACGTACGGGTTGGGGGACAGGA
AAGATCAGGGGGGCTACACCATGCACCAAGACCAAGAGGGTGACACGGACGCTGGCCTGAAAGAATCTCC
CCTGCAGACCCCCACTGAGGACGGATCTGAGGAACCGGGCTCTGAAACCTCTGATGCTAAGAGCACTCCA
ACAGCGGAAGATGTGACAGCACCCTTAGTGGATGAGGGAGCTCCCGGCAAGCAGGCTGCCGCGCAGCCCC
ACACGGAGATCCCAGAAGGAACCACAGCTGAAGAAGCAGGCATTGGAGACACCCCCAGCCTGGAAGACGA
AGCTGCTGGTCACGTGACCCAAGCTCGCATGGTCAGTAAAAGCAAAGACGGGACTGGAAGCGATGACAAA
AAAGCCAAGGGGGCTGATGGTAAAACGAAGATCGCCACACCGCGGGGAGCAGCCCCTCCAGGCCAGAAGG
GCCAGGCCAACGCCACCAGGATTCCAGCAAAAACCCCGCCCGCTCCAAAGACACCACCCAGCTCTGGTGA
ACCTCCAAAATCAGGGGATCGCAGCGGCTACAGCAGCCCCGGCTCCCCAGGCACTCCCGGCAGCCGCTCC
CGCACCCCGTCCCTTCCAACCCCACCCACCCGGGAGCCCAAGAAGGTGGCAGTGGTCCGTACTCCACCCA
AGTCGCCGTCTTCCGCCAAGAGCCGCCTGCAGACAGCCCCCGTGCCCATGCCAGACCTGAAGAATGTCAA
GTCCAAGATCGGCTCCACTGAGAACCTGAAGCACCAGCCGGGAGGCGGGAAGGTGCAAATAGTCTACAAA
CCAGTTGACCTGAGCAAGGTGACCTCCAAGTGTGGCTCATTAGGCAACATCCATCATAAACCAGGAGGTG
GCCAGGTGGAAGTAAAATCTGAGAAGCTTGACTTCAAGGACAGAGTCCAGTCGAAGATTGGGTCCCTGGA
CAATATCACCCACGTCCCTGGCGGAGGAAATAAAAAGATTGAAACCCACAAGCTGACCTTCCGCGAGAAC
GCCAAAGCCAAGACAGACCACGGGGCGGAGATCGTGTACAAGTCGCCAGTGGTGTCTGGGGACACGTCTC
CACGGCATCTCAGCAATGTCTCCTCCACCGGCAGCATCGACATGGTAGACTCGCCCCAGCTCGCCACGCT
AGCTGACGAGGTGTCTGCCTCCCTGGCCAAGCAGGGTTTGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001203252
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001203252.1, NP_001190181.1
RefSeq Size 5718 bp
RefSeq ORF 1233 bp
Locus ID 4137
UniProt ID P10636
Protein Families Druggable Genome
Protein Pathways Alzheimer's disease, MAPK signaling pathway
Gene Summary This gene encodes the microtubule-associated protein tau (MAPT) whose transcript undergoes complex, regulated alternative splicing, giving rise to several mRNA species. MAPT transcripts are differentially expressed in the nervous system, depending on stage of neuronal maturation and neuron type. MAPT gene mutations have been associated with several neurodegenerative disorders such as Alzheimer's disease, Pick's disease, frontotemporal dementia, cortico-basal degeneration and progressive supranuclear palsy. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (8) lacks three internal coding exons, as compared to variant 6. The reading frame is not affected, and the resulting isoform (8) has identical N- and C-termini but lacks three segments, as compared to isoform 6. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...