ZNF821 (NM_001201556) Human Untagged Clone

CAT#: SC331444

ZNF821 (untagged) - Homo sapiens zinc finger protein 821 (ZNF821), transcript variant 5



  "NM_001201556" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal ZNF821 Antibody
    • 100 ug

CNY 5808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
Sequence Data
>SC331444 representing NM_001201556.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCCCGTCGGAAACAGACAAATCCAAATAAAGTTCACTGGGATCAAGTATTTGCTGGGCTAGAAGAG
CAAGCCCGCCAGGCGATGATGAAAACTGATTTTCCTGGAGACCTTGGCAGTCAGCGACAAGCTATCCAA
CAACTAAGAGATCAGGACTCCAGTAGCAGTGACAGTGAGGGTGATGAAGAGGAGACGACACAAGATGAA
GTCTCTTCCCACACATCAGAGGAAGATGGAGGGGTGGTCAAAGTGGAGAAAGAGTTAGAAAATACAGAA
CAGCCTGTTGGTGGGAACGAAGTGGTAGAGCACGAGGTCACAGGGAATTTGAATTCTGACCCCTTGCTT
GAACTCTGCCAGTGTCCCCTCTGCCAGCTAGACTGCGGGAGCCGGGAGCAGTTGATTGCTCACGTGTAC
CAGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001201556
Insert Size 420 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001201556.1
RefSeq Size 1853 bp
RefSeq ORF 420 bp
Locus ID 55565
UniProt ID O75541
MW 15.5 kDa
Gene Summary This gene encodes a protein with two C2H2 zinc finger motifs and a score-and-three (23)-amino acid peptide repeat (STPR) domain. The STPR domain of the encoded protein binds to double stranded DNA and may also contain a nuclear localization signal, suggesting that this protein interacts with chromosomal DNA. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
Transcript Variant: This variant (5) lacks an exon in the 3' coding region, which results in a frameshift and an early stop codon, compared to variant 1. The encoded isoform (3) has a shorter C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...