WASF2 (NM_001201404) Human Untagged Clone

CAT#: SC331421

WASF2 (untagged) - Homo sapiens WAS protein family, member 2 (WASF2), transcript variant 2



  "NM_001201404" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-WASF2 Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms dJ393P12.2; IMD2; SCAR2; WASF4; WAVE2
Vector pCMV6-Entry
Sequence Data
>SC331421 representing NM_001201404.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCCGTTAGTAACGAGGAACATCGAGCCAAGGCACCTGTGCCGTCAGACGTTGCCTAGCGTTAGAAGC
GAGCTGGAATGCGTGACCAACATCACCCTGGCAAATGTCATCCGACAGCTGGGCAGCCTGAGTAAATAT
GCAGAGGACATTTTTGGAGAGCTCTTTACTCAGGCAAATACCTTTGCCTCTCGGGTAAGCTCCCTTGCT
GAGAGGGTCGACCGACTACAGGTTAAAGTCACTCAGCTGGATCCCAAGGAAGAAGAAGTGTCACTGCAA
GGAATCAACACCCGAAAAGCCTTCAGAAGTTCCACCATTCAAGACCAGAAGCTTTTTGACAGAAACTCT
CTCCCAGTGCCTGTCTTAGAAACATACAATACCTGTGATACTCCTCCCCCTCTCAACAATCTTACCCCT
TACAGGGACGATGGAAAAGAGGCACTCAAATTCTACACAGACCCTTCATACTTCTTTGATCTTTGGAAG
GAGAAGATGCTGCAGGACACCAAGGATATCATGAAAGAGAAGAGAAAGCATAGGAAAGAAAAGAAAGAT
AATCCAAATCGAGGGAATGTAAACCCACGTAAAATCAAGACACGTAAGGAAGAGTGGGAGAAAATGAAG
ATGGGGCAAGAATTTGTGGAGTCCAAAGAAAAGCTGGGGACTTCTGGGTATCCACCCACTTTGGTGTAC
CAGAATGGCAGCATTGGCTGTGTTGAAAACGTGGATGCAAGTAGCTATCCGCCACCACCACAGTCAGAC
TCTGCTTCTTCACCTTCTCCTTCCTTCTCCGAGGACAACTTGCCTCCTCCACCAGCAGAATTCAGGTTT
TCAGCTGCGCAGGGTTGA

Restriction Sites SgfI-MluI     
ACCN NM_001201404
Insert Size 846 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001201404.1
RefSeq Size 5161 bp
RefSeq ORF 846 bp
Locus ID 10163
UniProt ID Q9Y6W5
Protein Families Druggable Genome
Protein Pathways Adherens junction, Fc gamma R-mediated phagocytosis, Regulation of actin cytoskeleton
MW 32 kDa
Gene Summary This gene encodes a member of the Wiskott-Aldrich syndrome protein family. The gene product is a protein that forms a multiprotein complex that links receptor kinases and actin. Binding to actin occurs through a C-terminal verprolin homology domain in all family members. The multiprotein complex serves to tranduce signals that involve changes in cell shape, motility or function. The published map location (PMID:10381382) has been changed based on recent genomic sequence comparisons, which indicate that the expressed gene is located on chromosome 1, and a pseudogene may be located on chromosome X. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
Transcript Variant: This variant (2) lacks an alternate exon compared to variant 1, that causes a frameshift. The resulting isoform (2) has a shorter and distinct C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...