TECK (CCL25) (NM_001201359) Human Untagged Clone

CAT#: SC331413

CCL25 (untagged) - Homo sapiens chemokine (C-C motif) ligand 25 (CCL25), transcript variant 2



  "NM_001201359" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms Ckb15; Ck beta-15; SCYA25; TECK
Vector pCMV6-Entry
Sequence Data
>SC331413 representing NM_001201359.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAACCTGTGGCTCCTGGCCTGCCTGGTGGCCGGCTTCCTGGGAGCCTGGGCCCCCGCTGTCCACACC
CAAGGTGTCTTTGAGGACTGCTGCCTGGCCTACCACTACCCCATTGGGTGGGCTGTGCTCCGGCGCGCC
TGGACTTACCGGATCCAGGAGGTGAGCGGGAGCTGCAATCTGCCTGCTGCGATATTCTACCTCCCCAAG
AGACACAGGAAGGTGTGTGGGAACCCCAAAAGCAGGGAGGTGCAGAGAGCCATGAAGCTCCTGGATGCT
CGAAATAAGGTTTTTGCAAAGCTCCACCACAACACGCAGACCTTCCAAGGCCCTCATGCTGTAAAGAAG
TTGAGTTCTGGAAACTCCAAGTTATCATCGTCCAAGTTTAGCAATCCCATCAGCAGCAGTAAGAGGAAT
GTCTCCCTCCTGATATCAGCTAATTCAGGACTGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001201359
Insert Size 450 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001201359.1
RefSeq Size 999 bp
RefSeq ORF 450 bp
Locus ID 6370
UniProt ID O15444
Protein Families Druggable Genome, Secreted Protein
Protein Pathways Chemokine signaling pathway, Cytokine-cytokine receptor interaction
MW 16.5 kDa
Gene Summary This antimicrobial gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for dendritic cells, thymocytes, and activated macrophages but is inactive on peripheral blood lymphocytes and neutrophils. The product of this gene binds to chemokine receptor CCR9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
Transcript Variant: This variant (2) uses an alternate in-frame splice site compared to variant 1. The resulting isoform (2) is shorter compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...