Dexras1 (RASD1) (NM_001199989) Human Untagged Clone

CAT#: SC331395

RASD1 (untagged) - Homo sapiens RAS, dexamethasone-induced 1 (RASD1), transcript variant 2



  "NM_001199989" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
RASD1 Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AGS1; DEXRAS1; MGC:26290
Vector pCMV6-Entry
Sequence Data
>SC331395 representing NM_001199989.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAAACTGGCCGCGATGATCAAGAAGATGTGCCCGAGCGACTCGGAGCTGAGTATCCCGGCCAAGAAC
TGCTATCGCATGGTCATCCTCGGCTCGTCCAAGGTGGGCAAGACGGCCATCGTGTCGCGCTTCCTCACC
GGCCGCTTCGAGGACGCCTACACGCCTACCATCGAGGACTTCCACCGCAAGTTCTACTCCATCCGCGGC
GAGGTCTACCAGCTCGACATCCTCGACACGTCCGGCAACCACCCGTTCCCCGCCATGCGGCGCCTCTCC
ATCCTCACAGATCCTCGACACCAAGTCTTGCCTCAAGAACAAAACCAAGGAGAACGTGGACGTGCCCCT
GGTCATCTGCGGCAACAAGGGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001199989
Insert Size 369 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001199989.1
RefSeq Size 1740 bp
RefSeq ORF 369 bp
Locus ID 51655
UniProt ID Q9Y272
Protein Families Druggable Genome
MW 13.8 kDa
Gene Summary This gene encodes a member of the Ras superfamily of small GTPases and is induced by dexamethasone. The encoded protein is an activator of G-protein signaling and acts as a direct nucleotide exchange factor for Gi-Go proteins. This protein interacts with the neuronal nitric oxide adaptor protein CAPON, and a nuclear adaptor protein FE65, which interacts with the Alzheimer's disease amyloid precursor protein. This gene may play a role in dexamethasone-induced alterations in cell morphology, growth and cell-extracellular matrix interactions. Epigenetic inactivation of this gene is closely correlated with resistance to dexamethasone in multiple myeloma cells. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2011]
Transcript Variant: This variant (2) has an alternate splice site in the CDS that results in a frame-shift compared to variant 1. The resulting isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...