CMTM2 (NM_001199317) Human Untagged Clone
CAT#: SC331296
CMTM2 (untagged) - Homo sapiens CKLF-like MARVEL transmembrane domain containing 2 (CMTM2), transcript variant 2
CNY 2950.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CKLFSF2 |
Vector | pCMV6-Entry |
Sequence Data |
>SC331296 representing NM_001199317.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCACCTAAGGCGGCAAAGGGGGCCAAGCCAGAGCCAGCACCAGCTCCACCTCCACCCGGGGCCAAA CCCGAGGAAGACAAGAAGGACGGTAAGGAGCCATCGGACAAACCTCAAAAGGCGGTGCAGGACCATAAG GAGCCATCGGACAAACCTCAAAAGGCGGTGCAGCCCAAGCACGAAGTGGGCACGAGGAGGGGGTGTCGC CGCTACCGGTGGGAATTAAAAGACAGCAATAAAGAGTTCTGGCTCTTGGGGCACGCTGAGATCAAGATT CGGAGTTTGGACCTCTTCAACGACCTGATTGCTTGTGCGTTCCTTGTGGGAGCCGTGGTCTTTGCTGTG AGAAGTCGGCGATCCATGAATCTCCACTACTTACTTGCTGTGATCCTTATTGGTGCGGCTGGAGTTTTT GCTTTTATCGATGTGTGTCTTCAAAGAAACCACTTCAGAGGCAAGAAGGCCAAAAAGCATATGCTGGTT CCTCCTCCAGGAAAGGAAAAAGGACCCCAGCAGGGCAAGGGACCAGAACCCGCCAAGCCACCAGAACCT GGCAAGCCACCAGGGCCAGCAAAGGGAAAGAAATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001199317 |
Insert Size | 588 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001199317.1 |
RefSeq Size | 914 bp |
RefSeq ORF | 588 bp |
Locus ID | 146225 |
UniProt ID | Q8TAZ6 |
Protein Families | Transmembrane |
MW | 21.4 kDa |
Gene Summary | This gene belongs to the chemokine-like factor gene superfamily, a novel family that links the chemokine and the transmembrane 4 superfamilies of signaling molecules. The protein encoded by this gene may play an important role in testicular development. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks an in-frame exon in the coding region, compared to variant 1. The resulting protein (isoform 2) is shorter, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233405 | CMTM2 (Myc-DDK tagged) - Homo sapiens CKLF-like MARVEL transmembrane domain containing 2 (CMTM2), transcript variant 2 |
CNY 3990.00 |
|
RG233405 | CMTM2 (tGFP-tagged) - Homo sapiens CKLF-like MARVEL transmembrane domain containing 2 (CMTM2), transcript variant 2 |
CNY 4370.00 |