PSMC5 (NM_001199163) Human Untagged Clone

CAT#: SC331256

PSMC5 (untagged) - Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase, 5 (PSMC5), transcript variant 2



  "NM_001199163" in other vectors (2)

CNY 3800.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-PSMC5 Antibody
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms p45; p45/SUG; RPT6; S8; SUG-1; SUG1; TBP10; TRIP1
Vector pCMV6-Entry
Sequence Data
>SC331256 representing NM_001199163.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAGCTGGAGGAGGGGAAGGCAGGCAGCGGACTCCGCCAATATTATCTGTCCAAGATTGAAGAACTC
CAGCTGATTGTGAATGATAAGAGCCAAAACCTCCGGAGGCTGCAGGCACAGAGGAACGAACTAAATGCT
AAAGTTCGCCTATTGCGGGAGGAGCTACAGCTGCTGCAGGAGCAGGGCTCCTATGTGGGGGAAGTAGTC
CGGGCCATGGATAAGAAGAAAGTGTTGGTCAAGGTACATCCTGAAGGTAAATTTGTTGTAGACGTGGAC
AAAAACATTGACATCAATGATGTGACACCCAATTGCCGGGTGGCTCTAAGGAATGACAGCTACACTCTG
CACAAGATCCTGCCCAACAAGGTAGACCCATTAGTGTCACTGATGATGGTGGAGAAAGTACCAGATTCA
ACTTATGAGATGATTGGTGGACTGGACAAACAGATCAAGGAGATCAAAGAAGTGATCGAGCTGCCTGTT
AAGCATCCTGAGCTCTTCGAAGCACTGGGCATTGCTCAGCCCAAGGGAGTGCTGCTGTATGGACCTCCA
GGCACTGGGAAGACACTGTTGGCCCGGGCTGTGGCTCATCATACGGACTGTACCTTTATTCGTGTCTCT
GGCTCTGAACTGGTACAGAAATTCATAGGGGAAGGGGCAAGAATGGTGAGGGAGCTGTTTGTCATGGCA
CGGGAACATGCTCCATCTATCATCTTCATGGACGAAATCGACTCCATCGGCTCCTCGCGGCTGGAGGGG
GGTTCTGGAGGGGACAGTGAAGTGCAGCGCACGATGCTGGAGTTGCTCAACCAGCTCGACGGCTTTGAG
GCCACCAAGAACATCAAGGTTATCATGGCTACTAATAGGATTGATATCCTGGACTCGGCACTGCTTCGC
CCAGGGCGCATTGACAGAAAAATTGAATTCCCACCCCCCAATGAGGAGGCCCGGCTGGACATTTTGAAG
ATTCATTCTCGGAAGATGAACCTGACCCGGGGGATCAACCTGAGAAAAATTGCTGAGCTCATGCCAGGA
GCATCAGGGGCTGAAGTGAAGGGCGTGTGCACAGAAGCTGGCATGTATGCCCTGCGAGAACGGCGAGTC
CATGTCACTCAGGAGGACTTTGAGATGGCAGTAGCCAAGGTCATGCAGAAGGACAGTGAGAAAAACATG
TCCATCAAGAAATTATGGAAGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001199163
Insert Size 1197 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001199163.1
RefSeq Size 1507 bp
RefSeq ORF 1197 bp
Locus ID 5705
UniProt ID P62195
Protein Families Druggable Genome
Protein Pathways Proteasome
MW 44.8 kDa
Gene Summary The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases which have a chaperone-like activity. In addition to participation in proteasome functions, this subunit may participate in transcriptional regulation since it has been shown to interact with the thyroid hormone receptor and retinoid X receptor-alpha. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (2) is shorter at the N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...