AMID (AIFM2) (NM_001198696) Human Untagged Clone

CAT#: SC331220

AIFM2 (untagged) - Homo sapiens apoptosis-inducing factor, mitochondrion-associated, 2 (AIFM2), transcript variant 1



  "NM_001198696" in other vectors (2)

CNY 3610.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-AIFM2 Antibody
    • 50 ug

CNY 4628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AMID; FSP1; PRG3
Vector pCMV6-Entry
Sequence Data
>SC331220 representing NM_001198696.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGGTCCCAGGTCTCGGTGGAATCGGGAGCTCTGCACGTGGTGATTGTGGGTGGGGGCTTTGGCGGG
ATCGCAGCAGCCAGCCAGCTGCAGGCCCTGAACGTCCCCTTCATGCTGGTGGACATGAAGGACTCCTTC
CACCACAATGTGGCTGCTCTCCGAGCCTCCGTGGAGACAGGGTTCGCCAAAAAGACATTCATTTCTTAC
TCGGTGACTTTCAAGGACAACTTCCGGCAGGGGCTAGTAGTGGGGATAGACCTGAAGAACCAGATGGTG
CTGCTGCAGGGTGGCGAGGCCCTGCCCTTCTCTCATCTTATCCTGGCCACGGGCAGCACTGGGCCCTTC
CCGGGCAAGTTTAATGAGGTTTCCAGCCAGCAGGCCGCTATCCAGGCCTATGAGGACATGGTGAGGCAG
GTCCAGCGCTCACGGTTCATCGTGGTGGTGGGAGGAGGCTCGGCTGGAGTGGAGATGGCAGCAGAGATT
AAAACAGAATATCCTGAGAAAGAGGTCACTCTCATTCACTCCCAAGTGGCCCTGGCTGACAAGGAGCTC
CTGCCCTCCGTCCGGCAGGAAGTGAAGGAGATCCTCCTCCGGAAGGGCGTGCAGCTGCTGCTGAGTGAG
CGGGTGAGCAATCTGGAGGAGCTGCCTCTCAATGAGTATCGAGAGTACATCAAAGTGCAGACGGACAAA
GGCACAGAGGTGGCCACCAACCTGGTGATTCTCTGCACCGGCATCAAGATCAACAGCTCCGCCTACCGC
AAAGCGTTTGAGAGCAGACTAGCCAGCAGTGGTGCTCTGAGAGTGAACGAGCACCTCCAGGTGGAGGGC
CACAGCAACGTCTACGCCATTGGTGACTGTGCCGACGTGAGGACGCCCAAGATGGCCTATCTTGCCGGC
CTCCACGCCAACATCGCCGTGGCCAACATCGTCAACTCTGTGAAGCAGCGGCCTCTCCAGGCCTACAAG
CCGGGTGCACTGACGTTCCTCCTGTCCATGGGGAGAAATGACGGTGTGGGCCAAATCAGTGGCTTCTAT
GTGGGCCGGCTCATGGTTCGGCTGACCAAGAGCCGGGACCTGTTCGTCTCTACGAGCTGGAAAACCATG
AGGCAGTCTCCACCTTGA

Restriction Sites SgfI-MluI     
ACCN NM_001198696
Insert Size 1122 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001198696.1
RefSeq Size 3256 bp
RefSeq ORF 1122 bp
Locus ID 84883
UniProt ID Q9BRQ8
Protein Families Druggable Genome, Transmembrane
MW 40.5 kDa
Gene Summary This gene encodes a flavoprotein oxidoreductase that binds single stranded DNA and is thought to contribute to apoptosis in the presence of bacterial and viral DNA. The expression of this gene is also found to be induced by tumor suppressor protein p53 in colon cancer cells. [provided by RefSeq, Nov 2010]
Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...