RhoGDI (ARHGDIA) (NM_001185077) Human Untagged Clone
CAT#: SC331132
ARHGDIA (untagged) - Homo sapiens Rho GDP dissociation inhibitor (GDI) alpha (ARHGDIA), transcript variant 1
CNY 2950.00
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GDIA1; HEL-S-47e; NPHS8; RHOGDI; RHOGDI-1 |
Vector | pCMV6-Entry |
Sequence Data |
>SC331132 representing NM_001185077.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCTGAGCAGGAGCCCACAGCCGAGCAGCTGGCCCAGATTGCAGCGGAGAACGAGGAGGATGAGCAC TCGGTCAACTACAAGCCCCCGGCCCAGAAGAGCATCCAGGAGATCCAGGAGCTGGACAAGGACGACGAG AGCCTGCGAAAGTACAAGGAGGCCCTGCTGGGCCGCGTGGCCGTTTCCGCAGACCCCAACGTCCCCAAC GTCGTGGTGACTGGCCTGACCCTGGTGTGCAGCTCGGCCCCGGGCCCCCTGGAGCTGGACCTGACGGGC GACCTGGAGAGCTTCAAGAAGCAGTCGTTTGTGCTGAAGGAGGGTGTGGAGTACCGGATAAAAATCTCT TTCCGGGTTAACCGAGAGATAGTGTCCGGCATGAAGTACATCCAGCATACGTACAGGAAAGGCGTCAAG ATTGACAAGACTGACTACATGGTAGGCAGCTATGGGCCCCGGGCCGAGGAGTACGAGTTCCTGACCCCC GTGGAGGAGGCACCCAAGGGTATGCTGGCCCGGGGCAGCTACAGCATCAAGTCCCGCTTCACAGACGAC GACAAGACCGACCACCTGTCCTGGGAGTGGAATCTCACCATCAAGAAGGACTGGAAGGACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001185077 |
Insert Size | 615 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001185077.1 |
RefSeq Size | 2126 bp |
RefSeq ORF | 615 bp |
Locus ID | 396 |
UniProt ID | P52565 |
Protein Families | Druggable Genome |
Protein Pathways | Neurotrophin signaling pathway |
MW | 23.2 kDa |
Gene Summary | This gene encodes a protein that plays a key role in the regulation of signaling through Rho GTPases. The encoded protein inhibits the disassociation of Rho family members from GDP (guanine diphosphate), thereby maintaining these factors in an inactive state. Activity of this protein is important in a variety of cellular processes, and expression of this gene may be altered in tumors. Mutations in this gene have been found in individuals with nephrotic syndrome, type 8. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014] Transcript Variant: This variant (1) represents the longest transcript and encodes isoform (a). Variants 1 and 2 encode the same isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233427 | ARHGDIA (Myc-DDK tagged) - Homo sapiens Rho GDP dissociation inhibitor (GDI) alpha (ARHGDIA), transcript variant 1 |
CNY 2400.00 |
|
RG233427 | ARHGDIA (tGFP-tagged) - Homo sapiens Rho GDP dissociation inhibitor (GDI) alpha (ARHGDIA), transcript variant 1 |
CNY 4370.00 |