Kallikrein 15 (KLK15) (NM_001277081) Human Untagged Clone

CAT#: SC331084

KLK15 (untagged) - Homo sapiens kallikrein-related peptidase 15 (KLK15), transcript variant 5



  "NM_001277081" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
KLK15 rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ACO; HSRNASPH
Vector pCMV6-Entry
Sequence Data
>SC331084 representing NM_001277081.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTGGCTTCTCCTCACTCTCTCCTTCCTGCTGGCATCCACAGCCCAGGATGGTGACAAGTTGCTGGAA
GGTGACGAGTGTGCACCCCACTCCCAGCCATGGCAAGTGGCTCTCTACGAGCGTGGACGCTTTAACTGT
GGCGCTTCCCTCATCTCCCCACACTGGGTGCTGTCTGCGGCCCACTGCCAAAGCCGCTTCATGAGAGTG
CGCCTGGGAGAGCACAACCTGCGCAAGCGCGATGGCCCAGAGCAACTACGGACCACGTCTCGGGTCATT
CCACACCCGCGCTACGAAGCGCGCAGCCACCGCAACGACATCATGTTGCTGCGCCTAGTCCAGCCCGCA
CGCCTGAACCCCCAGGTGCGCCCCGCGGTGCTACCCACGCGTTGCCCCCACCCGGGGGAGGCCTGTGTG
GTGTCTGGCTGGGGCCTGGTGTCCCACAACGAGCCTGGGACCGCTGGGAGCCCCCGGTCACAAGTGAGT
CTCCCAGATACGTTGCATTGTGCCAACATCAGCATTATCTCGGACACATCTTGTGACAAGAGCTACCCA
GGGCGCCTGACAAACACCATGGTGTGTGCAGGCGCGGAGGGCAGAGGCGCAGAATCCTGTGAGGGTGAC
TCTGGGGGACCCCTGGTCTGTGGGGGCATCCTGCAGGGCATTGTGTCCTGGGGTGACGTCCCTTGTGAC
AACACCACCAAGCCTGGTGTCTATACCAAAGTCTGCCACTACTTGGAGTGGATCAGGGAAACCATGAAG
AGGAACTGA

Restriction Sites SgfI-RsrII     
ACCN NM_001277081
Insert Size 768 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001277081.1
RefSeq Size 1322 bp
RefSeq ORF 768 bp
Locus ID 55554
UniProt ID Q9H2R5
Protein Families Druggable Genome, Protease, Secreted Protein
MW 28 kDa
Gene Summary Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. In prostate cancer, this gene has increased expression, which indicates its possible use as a diagnostic or prognostic marker for prostate cancer. The gene contains multiple polyadenylation sites and alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (5) uses an alternate in-frame splice site in the 5' coding region, compared to variant 4, resulting in an isoform (5) that is 1 aa shorter than isoform 4.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...