YOD1 (NM_001276320) Human Untagged Clone

CAT#: SC331043

YOD1 (untagged) - Homo sapiens YOD1 deubiquitinase (YOD1), transcript variant 2



  "NM_001276320" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal YOD1 Antibody (C-term)
    • 400 ul

CNY 6,314.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DUBA8; OTUD2; PRO0907
Vector pCMV6-Entry
Sequence Data
>SC331043 representing NM_001276320.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAAACATTACATATAATTTATTCAGAAGCAAAGTCTTTTACAGTGGAGGGGCTGTCCAGCCGGACC
CGGGTGCGGGAACTCCAGGGCCAAATTGCCGCCATCACCGGGATCGCCCCCGGCGGTCAGCGAATCCTC
GTCGGATACCCTCCCGAGTGCCTGGATCTCAGCAATGGGGATACCATTCTGGAAGACTTGCCCATCCAA
TCTGGTGACATGCTGATCATTGAAGAAGACCAAACCAGGCCCAGAAGTTCACCTGCATTTACTAAACGT
GGTGCTTCTAGTTACGTCAGGGAAACTTTGCCTGTGCTTACCAGAACCGTGGTCCCAGCAGACAACTCT
TGCCTCTTTACTAGTGTGTACTATGTCGTCGAAGGAGGAGTCTTGAATCCAGCTTGTGCCCCTGAGATG
AGACGCCTCATAGCACAAATTGTAGCAAGCGATCCAGACTTCTATAGTGAGGCAATACTGGGAAAAACA
AATCAAGAGTACTGTGACTGGATCAAAAGGGATGACACTTGGGGAGGAGCAATAGAGATATCGATTTTG
TCCAAGTTTTACCAATGTGAAATATGTGTAGTGGATACACAGACAGTAAGAATTGATCGTTTTGGGGAA
GATGCAGGATATACCAAAAGGGTTCTGCTTATTTATGATGGCATCCACTATGATCCACTTCAGCGTAAC
TTCCCTGATCCAGATACACCTCCTCTGACCATTTTCTCCTCTAATGATGATATTGTTCTTGTACAAGCA
CTGGAATTAGCAGATGAAGCTAGAAGAAGGAGACAGTTTACTGATGTCAACCGCTTCACCCTGAGATGC
ATGGTATGTCAGAAAGGATTAACTGGACAAGCAGAAGCAAGGGAACATGCCAAGGAGACAGGCCATACC
AACTTTGGAGAAGTGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001276320
Insert Size 915 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001276320.1
RefSeq Size 6291 bp
RefSeq ORF 915 bp
Locus ID 55432
UniProt ID Q5VVQ6
Protein Pathways Biosynthesis of unsaturated fatty acids, Limonene and pinene degradation
MW 34 kDa
Gene Summary Protein ubiquitination controls many intracellular processes, including cell cycle progression, transcriptional activation, and signal transduction. This dynamic process, involving ubiquitin conjugating enzymes and deubiquitinating enzymes, adds and removes ubiquitin. Deubiquitinating enzymes are cysteine proteases that specifically cleave ubiquitin from ubiquitin-conjugated protein substrates. The protein encoded by this gene belongs to a DUB subfamily characterized by an ovarian tumor (OTU) domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Transcript Variant: This variant (2) contains alternate exons in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (2) has a distinct N-terminus and is shorter than isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...