RAB13 (NM_001272038) Human Untagged Clone

CAT#: SC331025

RAB13 (untagged) - Homo sapiens RAB13, member RAS oncogene family (RAB13), transcript variant 2



  "NM_001272038" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


RAB13 rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GIG4
Vector pCMV6-Entry
Sequence Data
>SC331025 representing NM_001272038.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGCATTATCCTAGTATACGACATCACGGATGAGAAATCTTTCGAGAATATTCAGAACTGGATGAAA
AGCATCAAGGAGAATGCCTCGGCTGGGGTGGAGCGCCTCTTGCTGGGGAACAAATGTGACATGGAGGCC
AAGAGGAAGGTGCAGAAGGAGCAGGCCGATAAGTTGGCTCGAGAGCATGGAATCCGATTTTTCGAAACT
AGTGCTAAATCCAGTATGAATGTGGATGAGGCTTTTAGTTCCCTGGCCCGGGACATCTTGCTCAAGTCA
GGAGGCCGGAGATCAGGAAACGGCAACAAGCCTCCCAGTACTGACCTGAAAACTTGTGACAAGAAGAAC
ACCAACAAGTGCTCCCTGGGCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001272038
Insert Size 369 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001272038.1
RefSeq Size 1353 bp
RefSeq ORF 369 bp
Locus ID 5872
UniProt ID P51153
Protein Families Druggable Genome
Protein Pathways Tight junction
MW 13.6 kDa
Gene Summary This gene is a member of the Rab family of small G proteins and plays a role in regulating membrane trafficking between trans-Golgi network (TGN) and recycling endosomes (RE). The encoded protein is involved in the assembly of tight junctions, which are components of the apical junctional complex (AJC) of epithelial cells. The AJC plays a role in forming a barrier between luminal contents and the underlying tissue. Additional functions associated with the protein include endocytic recycling of occludin, regulation of epithelial cell scattering, neuronal regeneration and regulation of neurite outgrowth. Alternately spliced transcript variants have been observed for this gene. A pseudogene associated with this gene is located on chromosome 12. [provided by RefSeq, Jan 2013]
Transcript Variant: This variant (2) contains a novel 5' terminal exon and uses a downstream start codon compared to variant 1. It encodes isoform 2 which is shorter compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...