HIGD1B (NM_001271880) Human Untagged Clone
CAT#: SC330992
HIGD1B (untagged) - Homo sapiens HIG1 hypoxia inducible domain family, member 1B (HIGD1B), transcript variant 2
CNY 2950.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CLST11240; CLST11240-15 |
Vector | pCMV6-Entry |
Sequence Data |
>SC330992 representing NM_001271880.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGTCTGCTAACAGACGCTGGTGGGTACCACCTGACGACGAAGACTGTGTGTCTGAGAAGCTCCTGAGG AAGACTCGGGAATCTCCACTGGTGCCTATAGGCTTAGGAGGCTGCTTGGTGGTAGCAGCATACAGGATT TACCGGCTGAGGTCTCGTGGTTCCACCAAGATGTCCATACACCTGATTCACACCCGAGTGGCAGCGCAG GCCTGTGCAGTGGGTGCAATCATGCTAGGTGCTGTGTACACAATGTACAGCGATTACGTCAAGAGGATG GCACAGGATGCTGGAGAGAAGTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001271880 |
Insert Size | 300 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001271880.1 |
RefSeq Size | 558 bp |
RefSeq ORF | 300 bp |
Locus ID | 51751 |
UniProt ID | Q9P298 |
Protein Families | Transmembrane |
MW | 11.1 kDa |
Gene Summary | This gene encodes a member of the hypoxia inducible gene 1 (HIG1) domain family. The encoded protein is localized to the cell membrane and has been linked to tumorigenesis and the progression of pituitary adenomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC231626 | HIGD1B (Myc-DDK tagged) - Homo sapiens HIG1 hypoxia inducible domain family, member 1B (HIGD1B), transcript variant 2 |
CNY 1200.00 |
|
RG231626 | HIGD1B (tGFP-tagged) - Homo sapiens HIG1 hypoxia inducible domain family, member 1B (HIGD1B), transcript variant 2 |
CNY 4370.00 |