PLA2G2D (NM_001271814) Human Untagged Clone
CAT#: SC330972
PLA2G2D (untagged) - Homo sapiens phospholipase A2, group IID (PLA2G2D), transcript variant 2
CNY 2950.00
货期*
4周
规格
Product images

推荐一起购买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | PLA2IID; sPLA2-IID; sPLA2S; SPLASH |
Vector | pCMV6-Entry |
Sequence Data |
>SC330972 representing NM_001271814.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGAACTTGCACTGCTGTGTGGGCTGGTGGTGATGGCTGGTGTGATTCCAATCCAGGGCGGGATCCTG AACCTGAACAAGATGGTCAAGCAAGTGACTGGGAAAATGCCCATCCTCTCCTACTGGCCCTACGGCTGT CACTGCGGACTAGGTGGCAGAGGCCAACCCAAAGATGCCACGGACTGCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001271814 |
Insert Size | 189 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001271814.1 |
RefSeq Size | 1878 bp |
RefSeq ORF | 189 bp |
Locus ID | 26279 |
UniProt ID | Q9UNK4 |
Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
Protein Pathways | alpha-Linolenic acid metabolism, Arachidonic acid metabolism, Ether lipid metabolism, Fc epsilon RI signaling pathway, Glycerophospholipid metabolism, GnRH signaling pathway, Linoleic acid metabolism, Long-term depression, MAPK signaling pathway, Metabolic pathways, Vascular smooth muscle contraction, VEGF signaling pathway |
MW | 6.6 kDa |
Gene Summary | This gene encodes a secreted member of the phospholipase A2 family, and is found in a cluster of related family members on chromosome 1. Phospholipase A2 family members hydrolyze the sn-2 fatty acid ester bond of glycerophospholipids to produce lysophospholipids and free fatty acid. This gene may be involved in inflammation and immune response, and in weight loss associated with chronic obstructive pulmonary disease. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2012] Transcript Variant: This variant (2) lacks an internal exon in the coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) has a shorter and distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
其它PLA2G2D产品
Customer
Reviews
Loading...