C5L2 (C5AR2) (NM_001271750) Human Untagged Clone

CAT#: SC330963

C5AR2 (untagged) - Homo sapiens complement component 5a receptor 2 (C5AR2), transcript variant 3



  "NM_001271750" in other vectors (2)

CNY 3230.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


C5AR2 rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C5L2; GPF77; GPR77
Vector pCMV6-Entry
Sequence Data
>SC330963 representing NM_001271750.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGGAACGATTCTGTCAGCTACGAGTATGGGGATTACAGCGACCTCTCGGACCGCCCTGTGGACTGC
CTGGATGGCGCCTGCCTGGCCATCGACCCGCTGCGCGTGGCCCCGCTCCCACTGTATGCCGCCATCTTC
CTGGTGGGGGTGCCGGGCAATGCCATGGTGGCCTGGGTGGCTGGGAAGGTGGCCCGCCGGAGGGTGGGT
GCCACCTGGTTGCTCCACCTGGCCGTGGCGGATTTGCTGTGCTGTTTGTCTCTGCCCATCCTGGCAGTG
CCCATTGCCCGTGGAGGCCACTGGCCGTATGGTGCAGTGGGCTGTCGGGCGCTGCCCTCCATCATCCTG
CTGACCATGTATGCCAGCGTCCTGCTCCTGGCAGCTCTCAGTGCCGACCTCTGCTTCCTGGCTCTCGGG
CCTGCCTGGTGGTCTACGGTTCAGCGGGCGTGCGGGGTGCAGGTGGCCTGTGGGGCAGCCTGGACACTG
GCCTTGCTGCTCACCGTGCCCTCCGCCATCTACCGCCGGCTGCACCAGGAGCACTTCCCAGCCCGGCTG
CAGTGTGTGGTGGACTACGGCGGCTCCTCCAGCACCGAGAATGCGGTGACTGCCATCCGGTTTCTTTTT
GGCTTCCTGGGGCCCCTGGTGGCCGTGGCCAGCTGCCACAGTGCCCTCCTGTGCTGGGCAGCCCGACGC
TGCCGGCCGCTGGGCACAGCCATTGTGGTGGGGTTTTTTGTCTGCTGGGCACCCTACCACCTGCTGGGG
CTGGTGCTCACTGTGGCGGCCCCGAACTCCGCACTCCTGGCCAGGGCCCTGCGGGCTGAACCCCTCATC
GTGGGCCTTGCCCTCGCTCACAGCTGCCTCAATCCCATGCTCTTCCTGTATTTTGGGAGGGCTCAACTC
CGCCGGTCACTGCCAGCTGCCTGTCACTGGGCCCTGAGGGAGTCCCAGGGCCAGGACGAAAGTGTGGAC
AGCAAGAAATCCACCAGCCATGACCTGGTCTCGGAGATGGAGGTGTAG

Restriction Sites SgfI-MluI     
ACCN NM_001271750
Insert Size 1014 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001271750.1
RefSeq Size 1357 bp
RefSeq ORF 1014 bp
Locus ID 27202
UniProt ID Q9P296
Protein Families Druggable Genome, GPCR, Transmembrane
MW 36.1 kDa
Gene Summary This gene encodes a G-protein coupled receptor 1 family member involved in the complement system of the innate immune response. Unlike classical G-protein coupled receptors, the encoded protein does not associate with intracellular G-proteins. It may instead modulate signal transduction through the beta-arrestin pathway, and may alternatively act as a decoy receptor. This gene may be involved in coronary artery disease and in the pathogenesis of sepsis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Transcript Variant: This variant (3) differs in the 5' UTR, compared to variant 1. Variants 1, 2, and 3 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...