CFAP410 (NM_001271442) Human Untagged Clone

CAT#: SC330936

C21orf2 (untagged) - Homo sapiens chromosome 21 open reading frame 2 (C21orf2), transcript variant 4



  "NM_001271442" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


CFAP410 rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C21orf2; LRRC76; RDMS; SMDAX; YF5/A2
Vector pCMV6-Entry
Sequence Data
>SC330936 representing NM_001271442.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCCCAGCCTGGAGGTGATCACGCTCAGCATCTCCACCCTGGAGCCTGTGAGCCGGTGCCAGCGCCTG
AGTGAGCTGTACCTGCGGAGGAACCGCATCCCCAGCCTGGCTGAGCTCTTCTACCTGAAGGGGCTGCCG
CGTCTGCGGGTGCTGTGGCTGGCCGAGAACCCGTGCTGCGGCACCAGCCCCCACCGCTACCGCATGACC
GTGCTGCGCACCCTGCCGCGCCTACAGAAGCTGGACAACCAGGCTGTGACGGAGGAGGAGCTGTCCCGT
GCACTGAGTGAGGGAGAGGAGATCACTGCGGCCCCAGAGAGAGAGGGCACAGGCCACGGCGGCCCCAAG
CTATGCTGCACACTGAGCTCCCTCAGCTCCGCTGCTGAGACTGGCCGGGACCCGCTGGACAGCGAGGAG
GAGGCAACCGGCGCCCAGGATGAACGTGGCCTGAAGCCGCCTTCCCGGGGCCAGTTTCCTTCCCTCTCA
GCCAGGGATGCCTCGAGCAGCCACAGGGGCAGGAACGTCCTGACTGCCATCCTGCTGCTGCTGCGGGAG
CTGGATGCAGAGGGGCTGGAGGCCGTGCAGCAGACTGTGGGCAGCCGGCTGCAGGCCCTGCGTGGGGAA
GAGGTGCAGGAGCACGCCGAGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001271442
Insert Size 645 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001271442.1
RefSeq Size 2159 bp
RefSeq ORF 645 bp
Locus ID 755
UniProt ID O43822
MW 23.6 kDa
Gene Summary Four alternatively spliced transcript variants encoding four different isoforms have been found for this nuclear gene. All isoforms contain leucine-rich repeats. Three of these isoforms are mitochondrial proteins and one of them lacks the target peptide, so is not located in mitochondrion. This gene is down-regulated in Down syndrome (DS) brain, which may represent mitochondrial dysfunction in DS patients. [provided by RefSeq, Sep 2012]
Transcript Variant: This variant (4) has an alternate 5' exon and an additional exon in the 5' region, which cause translation initiation at a downstream AUG, compared to variant 1. The resulting isoform (4, also known as A2) is shorter and lacks a mitochondrial targeting peptide, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...