ST3GAL6 (NM_001271146) Human Untagged Clone

CAT#: SC330925

ST3GAL6 (untagged) - Homo sapiens ST3 beta-galactoside alpha-2,3-sialyltransferase 6 (ST3GAL6), transcript variant 4



  "NM_001271146" in other vectors (2)

CNY 3230.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal ST3gal6 Antibody
    • 100 ug

CNY 5808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms SIAT10; ST3GALVI
Vector pCMV6-Entry
Sequence Data
>SC330925 representing NM_001271146.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAGAGGGTATCTTGTGGCCATATTCCTGAGTGCTGTCTTCCTCTATTATGTACTGCATTGCATATTA
TGGGGAACGAATGTCTATTGGGTGGCACCTGTGGAAATGAAACGGAGAAATAAGATCCAGCCTTGTTTA
TCAAAGCCAGCTTTTGCCTCTCTGCTGAGGTTTCATCAGTTTCACCCTTTTCTGTGTGCGGCTGATTTT
AGAAAGATTGCTTCCTTGTATGGTAGCGATAAGTTTGATTTGCCCTATGGGATGAGAACATCAGCGGAA
TATTTTCGACTTGCTCTTTCAAAACTGCAGAGTTGTGATCTCTTTGATGAGTTTGACAACATACCCTGT
AAAAAGTGTGTGGTGGTTGGTAATGGAGGAGTTTTGAAGAATAAGACATTAGGAGAAAAAATCGACTCC
TATGATGTAATAATAAGAATGAATAATGGTCCTGTTTTAGGACATGAAGAAGAAGTTGGGAGAAGGACA
ACCTTCCGACTTTTTTATCCAGAATCTGTTTTTTCAGATCCTATTCACAATGACCCTAATACGACAGTG
ATTCTCACTGCTTTTAAGCCACATGATTTAAGGTGGCTGTTGGAATTGTTGATGGGTGACAAAATAAAC
ACTAATGGTTTTTGGAAGAAACCAGCCTTAAACCTGATTTATAAACCTTATCAAATCCGAATATTAGAT
CCTTTCATTATCAGAACAGCAGCTTATGAACTGCTTCATTTTCCAAAAGTGTTTCCCAAAAATCAGAAA
CCTAAACACCCAACAACAGGAATTATTGCCATCACATTGGCGTTTTACATATGTCACGAAGTTCACCTA
GCTGGTTTTAAATACAACTTTTCTGACCTCAAGAGTCCTTTGCACTACTATGGGAATGCCACCATGTCT
TTGATGAATAAGAACGCGTATCACAATGTGACTGCAGAGCAGCTCTTTTTGAAGGACATTATAGAAAAA
AACCTCGTAATCAACTTGACTCAAGATTGA

Restriction Sites SgfI-RsrII     
ACCN NM_001271146
Insert Size 996 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001271146.1
RefSeq Size 3388 bp
RefSeq ORF 996 bp
Locus ID 10402
UniProt ID Q9Y274
Protein Families Transmembrane
Protein Pathways Glycosphingolipid biosynthesis - lacto and neolacto series, Metabolic pathways
MW 38.2 kDa
Gene Summary The protein encoded by this gene is a member of the sialyltransferase family. Members of this family are enzymes that transfer sialic acid from the activated cytidine 5'-monophospho-N-acetylneuraminic acid to terminal positions on sialylated glycolipids (gangliosides) or to the N- or O-linked sugar chains of glycoproteins. This protein has high specificity for neolactotetraosylceramide and neolactohexaosylceramide as glycolipid substrates and may contribute to the formation of selectin ligands and sialyl Lewis X, a carbohydrate important for cell-to-cell recognition and a blood group antigen. [provided by RefSeq, Apr 2016]
Transcript Variant: Variants 1, 4, 7, 8 and 9 encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...