UBE2W (NM_001271015) Human Untagged Clone

CAT#: SC330912

UBE2W (untagged) - Homo sapiens ubiquitin-conjugating enzyme E2W (putative) (UBE2W), transcript variant 3



  "NM_001271015" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


UBE2W rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms UBC-16; UBC16
Vector pCMV6-Entry
Sequence Data
>SC330912 representing NM_001271015.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTTGAGCCCCCGCGGCGTGACGCGAGCACGGCAGCTCCTCCCCCTGCGTCTCTGGCCTCGCCGGTCT
TGGGGGGATGGTTCCATCATGGCGTCAATGCAGAAACGACTACAGAAAGAACTGTTGGCTTTGCAAAAT
GACCCACCTCCTGGAATGACCTTAAATGAGAAGAGTGTTCAAAATTCAATTACACAGTGGATTGTAGAC
ATGGAAGGTGCACCAGGTACCTTATATGAAGGGGAAAAATTTCAACTTCTATTTAAATTTAGTAGTCGA
TATCCTTTTGACTCTCCTCAGGTCATGTTTACTGGTGAAAATATTCCTGTTCATCCTCATGTTTATAGC
AATGGTCATATCTGTTTATCCATTCTAACAGAAGACTGGTCCCCAGCGCTCTCAGTCCAATCAGTTTGT
CTTAGCATTATTAGCATGCTTTCCAGCTGCAAGGAAAAGAGACGACCACCGGATAATTCTTTTTATGTG
CGAACATGTAACAAGAATCCAAAGAAAACAAAATGGTGGTATCATGAACTGAAATCTGCCTTCATACTA
TCTATTACGGATTGA

Restriction Sites SgfI-MluI     
ACCN NM_001271015
Insert Size 567 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001271015.1
RefSeq Size 951 bp
RefSeq ORF 567 bp
Locus ID 55284
UniProt ID Q96B02
Protein Families Transcription Factors
Protein Pathways Ubiquitin mediated proteolysis
MW 21.6 kDa
Gene Summary This gene encodes a nuclear-localized ubiquitin-conjugating enzyme (E2) that, along with ubiquitin-activating (E1) and ligating (E3) enzymes, coordinates the addition of a ubiquitin moiety to existing proteins. The encoded protein promotes the ubiquitination of Fanconi anemia complementation group proteins and may be important in the repair of DNA damage. There is a pseudogene for this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Transcript Variant: This variant (3) lacks an alternate in-frame exon in the 5' coding region, lacks a portion of the 3' coding region, and differs in the 3' UTR, compared to variant 1. The encoded isoform (3) is shorter and has a distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...