MHF2 (CENPX) (NM_001271007) Human Untagged Clone

CAT#: SC330910

STRA13 (untagged) - Homo sapiens stimulated by retinoic acid 13 (STRA13), transcript variant 3



  "NM_001271007" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-STRA13 Antibody
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CENP-X; D9; FAAP10; MHF2; STRA13
Vector pCMV6-Entry
Sequence Data
>SC330910 representing NM_001271007.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAGGGAGCAGGAGCTGGATCCGGCTTCCGGAAGGAGCTGGTGAGCAGGCTGCTGCACCTGCACTTC
AAGGATGACAAGACCAAAGAAGCAGCAGTCCGCGGCGTGCGGCAGGCCCAGGCAGAAGACGCGCTCCGT
GTGGACGTGGACCAGCTGGAGAAGCTCCTGGACTTCTAG

Restriction Sites SgfI-MluI     
ACCN NM_001271007
Insert Size 177 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001271007.1
RefSeq Size 745 bp
RefSeq ORF 177 bp
Locus ID 201254
UniProt ID A8MT69
MW 6.5 kDa
Gene Summary DNA-binding component of the Fanconi anemia (FA) core complex. Required for the normal activation of the FA pathway, leading to monoubiquitination of the FANCI-FANCD2 complex in response to DNA damage, cellular resistance to DNA cross-linking drugs, and prevention of chromosomal breakage (PubMed:20347428, PubMed:20347429). In complex with CENPS (MHF heterodimer), crucial cofactor for FANCM in both binding and ATP-dependent remodeling of DNA. Stabilizes FANCM. In complex with CENPS and FANCM (but not other FANC proteins), rapidly recruited to blocked forks and promotes gene conversion at blocked replication forks (PubMed:20347428, PubMed:20347429). In complex with CENPS, CENPT and CENPW (CENP-T-W-S-X heterotetramer), involved in the formation of a functional kinetochore outer plate, which is essential for kinetochore-microtubule attachment and faithful mitotic progression (PubMed:19620631). As a component of MHF and CENP-T-W-S-X complexes, binds DNA and bends it to form a nucleosome-like structure (PubMed:20347428, PubMed:20347429). DNA-binding function is fulfilled in the presence of CENPS, with the following preference for DNA substates: Holliday junction > double-stranded > splay arm > single-stranded. Does not bind DNA on its own (PubMed:20347429).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) lacks an exon in the coding region, and uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. The encoded isoform (3) is shorter, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...