KLF7 (NM_001270944) Human Untagged Clone

CAT#: SC330897

KLF7 (untagged) - Homo sapiens Kruppel-like factor 7 (ubiquitous) (KLF7), transcript variant 4



  "NM_001270944" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


KLF7 mouse monoclonal antibody,clone OTI1A7
    • 100 ul

CNY 1999.00
CNY 2700.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms UKLF
Vector pCMV6-Entry
Sequence Data
>SC330897 representing NM_001270944.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTTCCCGTCTTGGCCAACATGCCTTGAATTGGAACGCTACCTACAGACGGAGCCCCGGAGGATCTCA
GAGACCTTTGGTGAGGACTTGGACTGTTTCCTCCACGCTTCCCCTCCCCCGTGCATTGAGGAAAGCTTC
CGTCGCTTAGACCCCCTGCTGCTCCCCGTGGAAGCGGCCATCTGTGAGAAGAGCTCGGCAGTGGACATC
TTGCTCTCTCGGGACAAGTTGCTATCTGAGACCTGCCTCAGCCTCCAGCCGGCCAGCTCTTCTCTAGAC
AGCTACACAGCCGTCAACCAGGCCCAGCTCAACGCAGTGACCTCATTAACGCCCCCATCGTCCCCTGAG
CTCAGCCGCCATCTGGTCAAAACCTCACAAACTCTCTCTGCCGTGGATGGCACGGTGACGTTGAAACTG
GTGGCCAAGAAGGCTGCTCTCAGCTCCGTAAAGGTGGGAGGGGTCGCAACAGCTGCAGCAGCCGTGACG
GCTGCGGGGGCCGTTAAGAGTGGACAGAGCGACAGTGACCAAGGAGGGCTAGGGGCTGAAGCATGTCCC
GAAAACAAGAAGAGGGTTCACCGCTGTCAGTTTAACGGGTGCCGGAAAGTTTATACAAAAAGCTCCCAC
TTAAAGGCCCACCAGAGGACTCACACAGGTGAGAAGCCTTATAAGTGCTCATGGGAGGGATGTGAGTGG
CGTTTTGCACGAAGCGATGAGCTCACGAGGCACTACAGGAAACACACAGGTGCAAAGCCCTTCAAATGC
AACCACTGCGACAGGTGTTTTTCCAGGTCTGACCATCTTGCCCTCCACATGAAGAGACATATCTAA

Restriction Sites SgfI-MluI     
ACCN NM_001270944
Insert Size 825 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001270944.1
RefSeq Size 7954 bp
RefSeq ORF 825 bp
Locus ID 8609
UniProt ID O75840
Protein Families Transcription Factors
MW 30.2 kDa
Gene Summary The protein encoded by this gene is a member of the Kruppel-like transcriptional regulator family. Members in this family regulate cell proliferation, differentiation and survival and contain three C2H2 zinc fingers at the C-terminus that mediate binding to GC-rich sites. This protein may contribute to the progression of type 2 diabetes by inhibiting insulin expression and secretion in pancreatic beta-cells and by deregulating adipocytokine secretion in adipocytes. A pseudogene of this gene is located on the long arm of chromosome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (4) has a distinct N-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...