BRP44L (MPC1) (NM_001270879) Human Untagged Clone
CAT#: SC330880
MPC1 (untagged) - Homo sapiens mitochondrial pyruvate carrier 1 (MPC1), transcript variant 2
CNY 2950.00
货期*
4周
规格
Product images

推荐一起购买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BRP44L; CGI-129; MPYCD; SLC54A1 |
Vector | pCMV6-Entry |
Sequence Data |
>SC330880 representing NM_001270879.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGAAAAAGTCTCCAGAGATTATCAGTGGGCGGATGACATTTGCCCTCTGTTGCTATTCTTTGACATTC ATGAGATTTGCCTACAAGGTACAGCCTCGGAACTGGCTTCTGTTTGCATGCCACGCAACAAATGAAGTA GCCCAGCTCATCCAGGGAGGGCGGCTTATCAAACACGAGATGACTAAAACGGCATCTGCATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001270879 |
Insert Size | 201 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001270879.1 |
RefSeq Size | 1193 bp |
RefSeq ORF | 201 bp |
Locus ID | 51660 |
MW | 7.5 kDa |
Gene Summary | The protein encoded by this gene is part of an MPC1/MPC2 heterodimer that is responsible for transporting pyruvate into mitochondria. The encoded protein is found in the inner mitochondrial membrane. Defects in this gene are a cause of mitochondrial pyruvate carrier deficiency. Several transcript variants, some protein coding and one non-protein coding, have been found for this gene. [provided by RefSeq, Aug 2012] Transcript Variant: This variant (2) contains an alternate exon compared to variant 1. This results in a distinct 5' UTR and causes translation initiation at a downstream start codon compared to variant 1. The resulting isoform (2) is shorter at the N-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...