Granzyme H (GZMH) (NM_001270781) Human Untagged Clone

CAT#: SC330878

GZMH (untagged) - Homo sapiens granzyme H (cathepsin G-like 2, protein h-CCPX) (GZMH), transcript variant 3



  "NM_001270781" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


GZMH rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CCP-X; CGL-2; CSP-C; CTLA1; CTSGL2
Vector pCMV6-Entry
Sequence Data
>SC330878 representing NM_001270781.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCAGCCATTCCTCCTCCTGTTGGCCTTTCTTCTGACCCCTGGGGCTGGGACAGAGGAGATCATCGGG
GGCCATGAGGCCAAGCCCCACTCCCGCCCCTACATGGCCTTTGTTCAGTTTCTGCAAGAGAAGAGTCGG
AAGAGGTGTGGCGGCATCCTAGTGAGAAAGGACTTTGTGCTGACAGCTGCTCACTGCCAGGGAAGCTCC
ATAAATGTCACCTTGGGGGCCCACAATATCAAGGAACAGGAGCGGACCCAGCAGTTTATCCCTGTGAAA
AGACCCATCCCCCATCCAGCCTATAATCCTAAGAACTTCTCCAACGACATCATGCTACTGCAGGGGGAC
TCCGGGGGGCCCCTCGTGTGTAAGGACGTAGCCCAAGGTATTCTCTCCTATGGAAACAAAAAAGGGACA
CCTCCAGGAGTCTACATCAAGGTCTCACACTTCCTGCCCTGGATAAAGAGAACAATGAAGCGCCTCTAA

Restriction Sites SgfI-MluI     
ACCN NM_001270781
Insert Size 483 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001270781.1
RefSeq Size 729 bp
RefSeq ORF 483 bp
Locus ID 2999
UniProt ID P20718
Protein Families Druggable Genome, Protease
MW 17.8 kDa
Gene Summary This gene encodes a member of the peptidase S1 family of serine proteases. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate a chymotrypsin-like protease. This protein is reported to be constitutively expressed in the NK (natural killer) cells of the immune system and may play a role in the cytotoxic arm of the innate immune response by inducing target cell death and by directly cleaving substrates in pathogen-infected cells. This gene is present in a gene cluster with another member of the granzyme subfamily on chromosome 14. [provided by RefSeq, Nov 2015]
Transcript Variant: This variant (3) lacks an alternate in-frame exon in the coding region compared to variant 1. It encodes isoform 3 which is shorter than isoform 1. This isoform (3) may undergo proteolytic processing similar to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...