CA6 (NM_001270502) Human Untagged Clone

CAT#: SC330855

CA6 (untagged) - Homo sapiens carbonic anhydrase VI (CA6), transcript variant 4



  "NM_001270502" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


CA6 rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CA-VI; GUSTIN
Vector pCMV6-Entry
Sequence Data
>SC330855 representing NM_001270502.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTGTCTGACTGGACCTACTCAGATTCACATTGTTCACTACAATTCTAAATACAAGAGCTATGATATA
GCCCAAGATGCGCCGGATGGTTTGGCTGTACTGGCAGCCTTCGTTGAGGTGAAGAATTACCCTGAAAAC
ACTTATTACAGCAACTTCATTTCTCATCTGGCCAACATCAAGTACCCAGGACAAAGAACAACCCTGACT
GGCCTTGACGTTCAGGACATGCTGCCCAGGAACCTCCAGCACTACTACACCTACCATGGCTCACTCACC
ACGCCTCCCTGCACTGAGAACGTCCACTGGTTTGTGCTGGCAGATTTTGTCAAGCTCTCCAGGACACAG
GTTTGGAAGCTGGAGAATTCCTTACTGGATCACCGCAACAAGACCATCCACAACGATTACCGCAGGACC
CAGCCCCTGAACCACAGAGTGGTGGAATCCAACTTCCCGAATCAGGAATACACTCTAGGCTCTGAATTC
CAGTTTTACCTACATAAGATTGAGGAAATTCTTGACTACTTAAGAAGAGCATTGAACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001270502
Insert Size 543 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001270502.1
RefSeq Size 1049 bp
RefSeq ORF 543 bp
Locus ID 765
Protein Families Druggable Genome, Secreted Protein
Protein Pathways Nitrogen metabolism
MW 21.2 kDa
Gene Summary The protein encoded by this gene is one of several isozymes of carbonic anhydrase. This protein is found only in salivary glands and saliva and protein may play a role in the reversible hydratation of carbon dioxide though its function in saliva is unknown. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (4) lacks two consecutive exons in the 5' coding region, compared to variant 1. The resulting isoform (4) has a shorter and distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...