TST (NM_001270483) Human Untagged Clone

CAT#: SC330849

TST (untagged) - Homo sapiens thiosulfate sulfurtransferase (rhodanese) (TST), transcript variant 2



  "NM_001270483" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal antibody to TST (thiosulfate sulfurtransferase (rhodanese))
    • 100 ul

CNY 6281.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms RDS
Vector pCMV6-Entry
Sequence Data
>SC330849 representing NM_001270483.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGTTCATCAGGTGCTCTACCGGGCGCTGGTCTCCACCAAGTGGCTGGCGGAGTCCATCAGGACTGGC
AAGCTGGGGCCCGGCCTGCGGGTGCTGGACGCGTCCTGGTACTCACCAGGCACCCGAGAGGCCCGCAAG
GAGTACCTCGAGCGCCACGTACCCGGCGCCTCTTTCTTTGACATAGAAGAGTGCCGGGACACGGCGTCG
CCCTACGAGATGATGCTGCCCAGCGAGGCTGGCTTCGCCGAGTATGTGGGCCGCCTGGGCATCAGCAAC
CACACGCACGTGGTGGTGTATGATGGTGAACACCTGGGCAGCTTCTATGCTCCCCGGGTCTGGTGGATG
TTCCGTGTGTTTGGCCACCGCACCGTATCAGTGCTCAATGGTGGCTTCCGGAACTGGCTGAAGGAGGGC
CACCCGGTGACATCCGAGCCCTCACGCCCAGAACCGGCCGTCTTCAAAGCCACACTGGACCGCTCCCTG
CTCAAGACCTACGAGCAGGTGCTGGAGAACCTTGAATCTAAGAGGTTCCAGCTGGTGGATTCAAGGTCT
CAAGGGCGGTTCCTGGGCACCGAGCCGGAGCCGGATGCAGTAGGACTGGACTCGGGCCATATCCGTGGT
GCCGTCAACATGCCTTTCATGGACTTCCTGACTGAGGATGGCTTCGAGAAGGGCCCAGAAGAGCTCCGT
GCTCTGTTCCAGACCAAGAAGGTGGATCTCTCGCAGCCTCTCATTGCCACGTGCCGCAAGGGAGTCACC
GCCTGCCACGTGGCCTTGGCTGCCTACCTCTGCGGCAAGCCTGATGTGGCCGTGTACGATGGCTCCTGG
TCCGAGTGGTTTCGCCGGGCCCCCCCAGAGAGCCGTGTGTCCCAGGGAAAGTCTGAGAAGGCCTGA

Restriction Sites SgfI-RsrII     
ACCN NM_001270483
Insert Size 894 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001270483.1
RefSeq Size 1111 bp
RefSeq ORF 894 bp
Locus ID 7263
UniProt ID Q16762
Protein Families Druggable Genome
MW 33.4 kDa
Gene Summary This is one of two neighboring genes encoding similar proteins that each contain two rhodanese domains. The encoded protein is localized to the mitochondria and catalyzes the conversion of thiosulfate and cyanide to thiocyanate and sulfite. In addition, the protein interacts with 5S ribosomal RNA and facilitates its import into the mitochondria. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Both variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...