IFT20 (NM_001267776) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC330786 representing NM_001267776. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCCAAGGACATCCTGGGTGAAGCAGGGCTACACTTTGATGAACTGAACAAGCTGAGGGTGTTGGAC CCAGAGGTTACCCAGCAGACCATAGAGCTGAAGGAAGAGTGCAAAGACTTTGTGGACAAAATTGGCCAG TTTCAGAAAATAGTTGGTGGTTTAATTGAGCTTGTTGATCAACTTGCAAAAGAAGCAGAAAATGAAAAG ATGAAGGCCATCGGTGCTCGGAACTTGCTCAAATCTATAGCAAAGCAGAGAGAAGCTCAACAGCAGCAA CTTCAAGCCCTAATAGCAGAAAAGAAAATGCAGCTAGAAAGGTATCGGGTTGAATATGAAGCTTTGTGT AAAGTAGAAGCAGAACAAAATGAATTTATTGACCAATTTATTTTTCAGAAATGA
Restriction Sites	SgfI-MluI
ACCN	NM_001267776
Insert Size	399 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001267776.1
RefSeq Size	888 bp
RefSeq ORF	399 bp
Locus ID	90410
UniProt ID	Q8IY31
MW	15.3 kDa
Gene Summary	This gene encodes a intraflagellar transport protein important for intracellular transport. The encoded protein forms part of a complex involved in trafficking of proteins from the Golgi body, including recycling of immune signalling components (Finetti et al., PubMed: 19855387). This gene is part of a complex set of sense-antisense loci that may be co-regulated. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. A pseudogene of this gene is located on the long arm of chromosome 14.[provided by RefSeq, Jun 2012] Transcript Variant: This variant (4) differs in the 5' UTR and uses a downstream in-frame start codon, compared to variant 1. Variants 3 and 4 encode the same isoform (3), which has a shorter N-terminus compared to isoform 1.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.