RPS3A (NM_001267699) Human Untagged Clone

CAT#: SC330778

RPS3A (untagged) - Homo sapiens ribosomal protein S3A (RPS3A), transcript variant 2



  "NM_001267699" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
RPS3A Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms FTE1; MFTL; S3A
Vector pCMV6-Entry
Sequence Data
>SC330778 representing NM_001267699.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGGCGGCAAAAAGGGAGCCAAGAAGAAAGTGGTTGAT
CCATTTTCTAAGAAAGATTGGTATGATGTGAAAGCACCTGCTATGTTCAATATAAGAAATATTGGAAAG
ACGCTCGTCACCAGGACCCAAGGAACCAACAATGATTGA

Restriction Sites SgfI-MluI     
ACCN NM_001267699
Insert Size 177 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001267699.1
RefSeq Size 1581 bp
RefSeq ORF 177 bp
Locus ID 6189
Protein Pathways Ribosome
MW 6.5 kDa
Gene Summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S3AE family of ribosomal proteins. It is located in the cytoplasm. Disruption of the gene encoding rat ribosomal protein S3a, also named v-fos transformation effector protein, in v-fos-transformed rat cells results in reversion of the transformed phenotype. This gene is co-transcribed with the U73A and U73B small nucleolar RNA genes, which are located in its fourth and third introns, respectively. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2012]
Transcript Variant: This variant (2) lacks an internal coding exon and differs at the 3' end compared to variant 1, which results in a frame-shift, and a shorter isoform (2) with a distinct C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...