INSL3 (NM_001265587) Human Untagged Clone

CAT#: SC330736

INSL3 (untagged) - Homo sapiens insulin-like 3 (Leydig cell) (INSL3), transcript variant 1



  "NM_001265587" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit anti-INSL3 Polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 2700.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ley-I-L; RLF; RLNL
Vector pCMV6-Entry
Sequence Data
>SC330736 representing NM_001265587.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGACCCCCGTCTGCCCGCCTGGGCGCTGGTGCTGCTGGGCCCTGCCCTGGTGTTCGCGTTGGGCCCC
GCGCCCACCCCAGAGATGCGTGAGAAGTTGTGCGGCCACCACTTCGTACGCGCGCTAGTGCGCGTGTGC
GGGGGCCCCCGCTGGTCCACCGAAGCCAGGAGGCCTGCGACCGGAGGCGACCAGAGGGAGTCTCACTCT
GTTTCCCAGGCTGGTCTCAAACTCCTGAGCTCAAGTAATCCTCCCACCTTGACCTTCCAAAGTGTTGGG
ATTAGCGATGTGAGTTGCTACAGTGGCTGGAGAGACGACATCTGCTCCATGGGCTGGTGGCCGACAGTA
ATCTCACGCTGGGACCTGGCCTGCAGCCCCTGCCCCAGACCTCTCACCATCACCGCCACCACCGTGCAG
CTGCCACCAACCCTGCACGCTACTGCTGCCTCAGTGGCTGTACCCAACAAGACCTGCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001265587
Insert Size 474 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001265587.1
RefSeq Size 928 bp
RefSeq ORF 474 bp
Locus ID 3640
UniProt ID P51460
Protein Families Druggable Genome, Secreted Protein
MW 16.9 kDa
Gene Summary This gene encodes a member of the insulin-like hormone superfamily. The encoded protein is mainly produced in gonadal tissues. Studies of the mouse counterpart suggest that this gene may be involved in the development of urogenital tract and female fertility. This protein may also act as a hormone to regulate growth and differentiation of gubernaculum, and thus mediating intra-abdominal testicular descent. Mutations in this gene may lead to cryptorchidism. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2012]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...