Translin (TSN) (NM_001261401) Human Untagged Clone

CAT#: SC330703

TSN (untagged) - Homo sapiens translin (TSN), transcript variant 2



  "NM_001261401" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TSN mouse monoclonal antibody,clone OTI1B5
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BCLF-1; C3PO; RCHF1; REHF-1; TBRBP; TRSLN
Vector pCMV6-Entry
Sequence Data
>SC330703 representing NM_001261401.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCTGTGAGCGAGATCTTCGTGGAGCTGCAGGGCTTTTTGGCTGCCGAGCAGGACATCCGAGAGGAA
ATCAGAAAAGTTGTACAGAGTTTAGAACAAACAGCTCGAGAGATTTTAACTCTACTGCAAGGGGTCCAT
CAGGGTGCTGGGTTTCAGGACATTCCAAAGAGGTGTTTGAAAGCTCGAGAACATTTTGGTACAGTAAAA
ACACATCTAACATCTTTGAAGACCAAATTTCCTGCTGAACAGTATTACAGATTTCATGAGCACTGGAGG
TTTGTGTTGCAGCGCTTGGTCTTCTTGGCAGCATTTGTTGTGTATTTGGAAACAGAAACACTAGTGACT
CGAGAAGCAGTTACAGAAATTCTTGGCATCGAGGCTGTCTGTCAACAGCGTGACTGCTGGAGACTACTC
CCGACCCCTCCACATCTCCACCTTCATCAATGA

Restriction Sites SgfI-MluI     
ACCN NM_001261401
Insert Size 447 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001261401.1
RefSeq Size 3328 bp
RefSeq ORF 447 bp
Locus ID 7247
UniProt ID Q15631
MW 17.3 kDa
Gene Summary This gene encodes a DNA-binding protein which specifically recognizes conserved target sequences at the breakpoint junction of chromosomal translocations. Translin polypeptides form a multimeric structure that is responsible for its DNA-binding activity. Recombination-associated motifs and translin-binding sites are present at recombination hotspots and may serve as indicators of breakpoints in genes which are fused by translocations. These binding activities may play a crucial role in chromosomal translocation in lymphoid neoplasms. This protein encoded by this gene, when complexed with translin-associated protein X, also forms a Mg ion-dependent endoribonuclease that promotes RNA-induced silencing complex (RISC) activation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2012]
Transcript Variant: This variant (2) lacks an exon in the 3' coding region, compared to variant 1, which results in a frameshift and a protein (isoform 2) with a shorter and distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...