HMBS (NM_001258209) Human Untagged Clone

CAT#: SC330637

HMBS (untagged) - Homo sapiens hydroxymethylbilane synthase (HMBS), transcript variant 4



  "NM_001258209" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
HMBS mouse monoclonal antibody, clone OTI3F4 (formerly 3F4)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PBG-D; PBGD; PORC; UPS
Vector pCMV6-Entry
Sequence Data
>SC330637 representing NM_001258209.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAGAGTGATTCGCGTGGGTACCCGCAAGAGCCAGCTTGCTCGCATACAGACGGACAGTGTGGTGGCA
ACATTGAAAGCCTCGTACCCTGGCCTGCAGTTTGAAATCATTGCTATGTCCACCACAGGGGACAAGATT
CTTGATACTGCACTCTCTAAGATTGGAGAGAAAAGCCTGTTTACCAAGGAGCTTGAACATGCCCTGGAG
AAGAATGAAGTGGACCTGGTTGTTCACTCCTTGAAGGACCTGCCCACTGTGCTTCCTCCTGGCTTCACC
ATCGGAGCCATCTGCAAGCGGGAAAACCCTCATGATGCTGTTGTCTTTCACCCAAAATTTGTTGGGAAG
ACCCTAGAAACCCTGCCAGAGAAGAGTGTGGTGGGAACCAGCTCCCTGCGAAGAGCAGCCCAGCTGCAG
AGAAAGTTCCCGCATCTGGAGTTCAGGAGTATTCGGGGAAACCTCAACACCCGGCTTCGGAAGCTGGAC
GAGCAGCAGGAGTTCAGTGCCATCATCCTGGCAACAGCTGGCCTGCAGCGCATGGGCTGGCACAACCGG
GTGGGGCAGATCCTGCACCCTGAGGAATGCATGTATGCTGTGGGCCAGGAAGGAGGCTGCAGTGTGCCA
GTAGCCGTGCATACAGCTATGAAGGATGGGCAACTGTACCTGACTGGAGGAGTCTGGAGTCTAGACGGC
TCAGATAGCATACAAGAGACCATGCAGGCTACCATCCATGTCCCTGCCCAGCATGAAGATGGCCCTGAG
GATGACCCACAGTTGGTAGGCATCACTGCTCGTAACATTCCACGAGGGCCCCAGTTGGCTGCCCAGAAC
TTGGGCATCAGCCTGGCCAACTTGTTGCTGAGCAAAGGAGCCAAAAACATCCTGGATGTTGCACGGCAG
CTTAACGATGCCCATTAA

Restriction Sites SgfI-MluI     
ACCN NM_001258209
Insert Size 915 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001258209.1
RefSeq Size 1497 bp
RefSeq ORF 915 bp
Locus ID 3145
UniProt ID P08397
Protein Families Druggable Genome
Protein Pathways Metabolic pathways, Porphyrin and chlorophyll metabolism
MW 33.3 kDa
Gene Summary This gene encodes a member of the hydroxymethylbilane synthase superfamily. The encoded protein is the third enzyme of the heme biosynthetic pathway and catalyzes the head to tail condensation of four porphobilinogen molecules into the linear hydroxymethylbilane. Mutations in this gene are associated with the autosomal dominant disease acute intermittent porphyria. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (4) uses an alternate splice junction at the 3' end of the first exon and lacks an alternate in-frame exon compared to variant 1. The resulting isoform (4) is shorter at the N-terminus and lacks an alternate internal segment compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...