CD63 (NM_001257400) Human Untagged Clone

CAT#: SC330616

CD63 (untagged) - Homo sapiens CD63 molecule (CD63), transcript variant 8



  "NM_001257400" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Purified CD63 mouse monoclonal antibody, clone OTI5E5 (formerly 5E5)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms LAMP-3; ME491; MLA1; OMA81H; TSPAN30
Vector pCMV6-Entry
Sequence Data
>SC330616 representing NM_001257400.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGATCACGTTTGCCATCTTTCTGTCTCTTATCATGTTGGTGGAGGTGGCCGCAGCCATTGCTGGCTAT
GTGTTTAGAGATAAGGTGATGTCAGAGTTTAATAACAACTTCCGGCAGCAGATGGAGAATTACCCGAAA
AACAACCACACTGCTTCGATCCTGGACAGGATGCAGGCAGATTTTAAGTGCTGTGGGGCTGCTAACTAC
ACAGATTGGGAGAAAATCCCTTCCATGTCGAAGAACCGAGTCCCCGACTCCTGCTGCATTAATGTTACT
GTGGGCTGTGGGATTAATTTCAACGAGAAGGCGATCCATAAGGAGGGCTGTGTGGAGAAGATTGGGGGC
TGGCTGAGGAAAAATGTGCTGGTGGTAGCTGCAGCAGCCCTTGGAATTGCTTTTGTCGAGGTTTTGGGA
ATTGTCTTTGCCTGCTGCCTCGTGAAGAGTATCAGAAGTGGCTACGAGGTGATGTAG

Restriction Sites SgfI-MluI     
ACCN NM_001257400
Insert Size 471 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001257400.1
RefSeq Size 806 bp
RefSeq ORF 471 bp
Locus ID 967
UniProt ID P08962
Protein Families Druggable Genome, Transmembrane
Protein Pathways Lysosome
MW 17.3 kDa
Gene Summary The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. The encoded protein is a cell surface glycoprotein that is known to complex with integrins. It may function as a blood platelet activation marker. Deficiency of this protein is associated with Hermansky-Pudlak syndrome. Also this gene has been associated with tumor progression. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Apr 2012]
Transcript Variant: This variant (8) contains a distinct 5' UTR exon and lacks an in-frame portion of the 5' coding region, compared to variant 1. The resulting isoform (D) has a shorter N-terminus, compared to isoform A. Variants 8 and 9 encode the same isoform D.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...