RHNO1 (NM_001257097) Human Untagged Clone

CAT#: SC330565

RHNO1 (untagged) - Homo sapiens RAD9-HUS1-RAD1 interacting nuclear orphan 1 (RHNO1), transcript variant 4



  "NM_001257097" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
C12orf32 mouse monoclonal antibody,clone OTI2C12
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C12orf32; HKMT1188; RHINO
Vector pCMV6-Entry
Sequence Data
>SC330565 representing NM_001257097.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCCTCCCAGAAAAAAACGCCGCCAGCCTTCCCAGAAAGCCCCGCTGCTGTTCCACCAACAACCACTG
GAGGGCCCCAAACACAGCTGTGCATCTACACAGCTTCCCATCACTCACACTCGACAGGTGCCCAGCAAG
CCCATTGACCACAGCACCATCACTTCCTGGGTATCACCTGATTTTGATACAGCAGCAGGAAGCTTGTTC
CCAGCCTACCAGAAACACCAAAACCGGGCGAGACACTCAAGTCGAAAACCTACCACCTCCAAGTTTCCA
CATCTAACTTTTGAGAGTCCGCAATCTTCCAGTTCAGAGACATTGGGGATCCCCTTAATCCGAGAGTGC
CCCAGTGAATCAGAAAAGGATGTTTCCAGAAGACCCTTAGTTCCAGTGCTCAGTCCCCAAAGCTGTGGG
AACATGTCAGTGCAGGCACTTCAGAGCTTACCTTATGTGTTCATTCCACCTGATATCCAGACCCCAGAG
TCATCGTCTGTGAAGGAAGAACTCATTCCCCAAGATCAGAAGGAAAACAGCCTTCTAAGCTGCACTCTT
CACACTGGCACTCCTAATAGCCCAGAGCCTGGACCTGTTCTGGTTAAAGACACCCCCGAGGACAAGTAT
GGAATAAAGGTCACATGGAGGAGACGACAGCACCTGCTTGCTTACCTCAGGGAGAGAGGGAAGCTGAGC
AGAAGCCAATTCCTTGTGAAAAGCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001257097
Insert Size 717 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001257097.1
RefSeq Size 2083 bp
RefSeq ORF 717 bp
Locus ID 83695
UniProt ID Q9BSD3
MW 26.7 kDa
Gene Summary Plays a role in DNA damage response (DDR) signaling upon genotoxic stresses such as ionizing radiation (IR) during the S phase. Recruited to sites of DNA damage through interaction with the 9-1-1 cell-cycle checkpoint response complex and TOPBP1 in a ATR-dependent manner. Required for the progression of the G1 to S phase transition. Plays a role in the stimulation of CHEK1 phosphorylation.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 1. Variants 1, 4 and 5 all encode isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...