ABR (NM_001256847) Human Untagged Clone

CAT#: SC330533

ABR (untagged) - Homo sapiens active BCR-related (ABR), transcript variant 4



  "NM_001256847" in other vectors (2)

CNY 3040.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


ABR rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MDB
Vector pCMV6-Entry
Sequence Data
>SC330533 representing NM_001256847.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGACCGACGTCCTGCCCCAGCCCGACTGCAGCCCGAAGGCGGGGCGCGAACCCCTGGCGCTGGAGGAG
TCGGGGAGCAAGCGCCCCCCCAACACCGGCGCCCGGCTCTGGGGCCGCGTGCGCAACAAGCTGCTCCGA
AACAAGCTGGACCCACAAACCGTGGAGACCAAGAACTGGCACACGGACGTGATTGAGATGAACGGGATC
AAAGTGGAATTTTCCATGAAATTCACCAGCCGAGATATGAGCCTGAAGAGGACCCCGTCCAAAAAGCAG
ACCGGCGTCTTCGGTGTGAAGATCAGCGTGGTGACGAAGCGGGAGCGCTCCAAGGTGCCCTACATCGTC
CGGCAGTGTGTGGAGGAGGTGGAGAAGAGGGGTATCGAGGAGGTTGGCATCTACAGGATATCGGGCGTG
GCCACGGACATCCAGGCGCTCAAGGCCGTCTTCGATGCCAATAACAAGGACATCCTGCTGATGCTGAGT
GACATGGACATCAACGCCATCGCCGGGACGCTCAAGCTGTACTTCCGGGAACTGCCCGAGCCGCTCCTC
ACGGACCGACTCTACCCAGCCTTCATGGAGGGCATCGCCCTGTCAGACCCTGCTGCCAAGGAAAACTGC
ATGATGCACCTGCTCCGCTCCCTGCCCGACCCCAACCTCATCACCTTCCTCTTCCTGCTGGAACACTTG
AAAAGGGTTGCCGAGAAGGAGCCCATCAACAAAATGTCACTTCACAACCTGGCTACCGTGTTTGGACCC
ACGTTACTGAGACCCTCAGAAGTGGAGAGCAAAGCACACCTCACCTCGGCTGCGGACATCTGGTCCCAT
GACGTCATGGCGCAGGTCCAGGTCCTCCTCTACTACCTGCAGCACCCCCCCATTTCCTTCGCAGAACTC
AAGCGGAACACACTGTACTTCTCCACCGACGTGTAG

Restriction Sites SgfI-MluI     
ACCN NM_001256847
Insert Size 933 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001256847.2
RefSeq Size 3601 bp
RefSeq ORF 933 bp
Locus ID 29
UniProt ID Q12979
MW 35.1 kDa
Gene Summary This gene encodes a protein that is similar to the protein encoded by the breakpoint cluster region gene located on chromosome 22. The protein encoded by this gene contains a GTPase-activating protein domain, a domain found in members of the Rho family of GTP-binding proteins. Functional studies in mice determined that this protein plays a role in vestibular morphogenesis. Alternatively spliced transcript variants have been reported for this gene. [provided by RefSeq, Feb 2012]
Transcript Variant: This variant (4) differs in the 5' UTR, lacks a large portion of the coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (d) has a distinct N-terminus and is shorter than isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...