Apc10 (ANAPC10) (NM_001256710) Human Untagged Clone

CAT#: SC330506

ANAPC10 (untagged) - Homo sapiens anaphase promoting complex subunit 10 (ANAPC10), transcript variant 6



  "NM_001256710" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Anti-ANAPC10 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms APC10; DOC1
Vector pCMV6-Entry
Sequence Data
>SC330506 representing NM_001256710.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGACTACACCAAACAAGACACCTCCTGGTGCTGACCCCAAGCAGTTGGAAAGGACTGGAACAGTACGG
GAAATTGGGTCACAAGCTGTTTGGTCACTCTCATCTTGCAAACCAGGATTTGGAGTGGATCAGTTACGA
GATGACAATCTAGAAACTTATTGGCAATCAGATGGTTCCCAGCCTCATTTAGTGAACATCCAATTCAGA
AGAAAAACAACAGTGAAGACATTATGTATTTATGCAGACTACAAATCTGATGAAAGCTATACTCCAAGC
AAGATCTCAGTCAGAGTAGGAAATAATTTTCACAACCTTCAAGAAATTCGGGCTTTGGTATCAGGATGA

Restriction Sites SgfI-MluI     
ACCN NM_001256710
Insert Size 345 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001256710.1
RefSeq Size 1506 bp
RefSeq ORF 345 bp
Locus ID 10393
UniProt ID Q9UM13
Protein Families Druggable Genome
Protein Pathways Cell cycle, Oocyte meiosis, Progesterone-mediated oocyte maturation, Ubiquitin mediated proteolysis
MW 12.8 kDa
Gene Summary ANAPC10 is a core subunit of the anaphase-promoting complex (APC), or cyclosome, a ubiquitin protein ligase that is essential for progression through the cell cycle. APC initiates sister chromatid separation by ubiquitinating the anaphase inhibitor securin (PTTG1; MIM 604147) and triggers exit from mitosis by ubiquitinating cyclin B (CCNB1; MIM 123836), the activating subunit of cyclin-dependent kinase-1 (CDK1; MIM 116940) (summary by Wendt et al., 2001 [PubMed 11524682]).[supplied by OMIM, Feb 2011]
Transcript Variant: This variant (6) includes an alternate exon in the 3' coding region, which results in a frameshift, compared to variant 1. Variants 6 and 7 encode the same isoform (3), which is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...