TMPRSS3 (NM_001256317) Human Untagged Clone

CAT#: SC330393

TMPRSS3 (untagged) - Homo sapiens transmembrane protease, serine 3 (TMPRSS3), transcript variant F



  "NM_001256317" in other vectors (2)

CNY 4,370.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal anti-TMPRSS3 antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DFNB8; DFNB10; ECHOS1; TADG12
Vector pCMV6-Entry
Sequence Data
>SC330393 representing NM_001256317.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGGGAAAATGATCCGCCTGCTGTTGAAGCCCCCTTCTCATTCCGATCGCTTTTTGGCCTTGATGAT
TTGAAAATAAGTCCTGTTGCACCAGATGCAGATGCTGTTGCTGCACAGATCCTGTCACTGCTGCCATTG
AAGTTTTTTCCAATCATCGTCATTGGGATCATTGCATTGATATTAGCACTGGCCATTGGTCTGGGCATC
CACTTCGACTGCTCAGGGAAGTACAGATGTCGCTCATCCTTTAAGTGTATCGAGCTGATAGCTCGATGT
GACGGAGTCTCGGATTGCAAAGACGGGGAGGACGAGTACCGCTGTGTCCGGGTGGGTGGTCAGAATGCC
GTGCTCCAGGTGTTCACAGCTGCTTCGTGGAAGACCATGTGCTCCGATGACTGGAAGGGTCACTACGCA
AATGTTGCCTGTGCCCAACTGGGTTTCCCAAGCTATGTGAGTTCAGATAACCTCAGAGTGAGCTCGCTG
GAGGGGCAGTTCCGGGAGGAGTTTGTGTCCATCGATCACCTCTTGCCAGATGACAAGGTGACTGCATTA
CACCACTCAGTATATGTGAGGGAGGGATGTGCCTCTGGCCACGTGGTTACCTTGCAGTGCACAGCCTGT
GGTCATAGAAGGGGCTACAGCTCACGCATCGTGGGTGGAAACATGTCCTTGCTCTCGCAGTGGCCCTGG
CAGGCCAGCCTTCAGTTCCAGGGCTACCACCTGTGCGGGGGCTCTGTCATCACGCCCCTGTGGATCATC
ACTGCTGCACACTGTGTTTATGACTTGTACCTCCCCAAGTCATGGACCATCCAGGTGGGTCTAGTTTCC
CTGTTGGACAATCCAGCCCCATCCCACTTGGTGGAGAAGATTGTCTACCACAGCAAGTACAAGCCAAAG
AGGCTGGGCAATGACATCGCCCTTATGAAGCTGGCCGGGCCACTCACGTTCAATGAAATGATCCAGCCT
GTGTGCCTGCCCAACTCTGAAGAGAACTTCCCCGATGGAAAAGTGTGCTGGACGTCAGGATGGGGGGCC
ACAGAGGATGGAGGTGACGCCTCCCCTGTCCTGAACCACGCGGCCGTCCCTTTGATTTCCAACAAGATC
TGCAACCACAGGGACGTGTACGGTGGCATCATCTCCCCCTCCATGCTCTGCGCGGGCTACCTGACGGGT
GGCGTGGACAGCTGCCAGGGGGACAGCGGGGGGCCCCTGGTGTGTCAAGAGAGGAGGCTGTGGAAGTTA
GTGGGAGCGACCAGCTTTGGCATCGGCTGCGCAGAGGTGAACAAGCCTGGGGTGTACACCCGTGTCACC
TCCTTCCTGGACTGGATCCACGAGCAGATGGAGAGAGACCTAAAAACCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001256317
Insert Size 1362 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256317.1
RefSeq Size 2460 bp
RefSeq ORF 1362 bp
Locus ID 64699
UniProt ID P57727
Protein Families Druggable Genome, Protease, Transmembrane
MW 49.3 kDa
Gene Summary This gene encodes a protein that belongs to the serine protease family. The encoded protein contains a serine protease domain, a transmembrane domain, an LDL receptor-like domain, and a scavenger receptor cysteine-rich domain. Serine proteases are known to be involved in a variety of biological processes, whose malfunction often leads to human diseases and disorders. This gene was identified by its association with both congenital and childhood onset autosomal recessive deafness. This gene is expressed in fetal cochlea and many other tissues, and is thought to be involved in the development and maintenance of the inner ear or the contents of the perilymph and endolymph. This gene was also identified as a tumor-associated gene that is overexpressed in ovarian tumors. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2012]
Transcript Variant: This variant (F) uses an alternate in-frame splice site in the central coding region, compared to variant A, resulting in an isoform (4) that is 1 aa shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...